Buscar

... INDIANA UNIVERSITY Mechanisms of ischemic skeletal muscle regeneration mediated by mechanically constrained human allogeneic mesenchymal stromal cell Alex O'Connor', Michael Loke2 , Chang-Hyun Gi13 , Katherin Leckie3, Theresa 0olron 3 , Leni Moldovan3 , Justin King3 , Steven Welc4 Steven Miller", Michael Murphy3 1lndiana University School of Medicine, 2Marian University College of Osteopathic Medicine, 3 1ndiana University School of Medicine, Department of Vascular Surgery, ' Department of Anatomy, Cell Biology & Physiology, Ind iana University School of Medicine SCHOOL OF MEDICINE MATERIALS and METHODS INTRODUCTION ~-==-=-===~=": .~=.. . RESULTS CONTINUED _ _ _ _ _ _ __, . , , _ _ _.,. ... N..,. =..-==-~__,.,.JO_._._._.. . ::..:.::.::.=-..- -............ ......___ _...... .......... --------------------- .a::"="'...:.-=~=:.:=:=----== . .,_,._(U,11.,.HO! =,"'-_,___..,:lc.c- ~I.. . 1 .~.., --=,- BACKGROUND I ':;' ____ _.,~-----""'... ......_...., _ _.., _ _o_ 0 ~!~ ==-: :=-:. . __,,fl6ftollftlll~Mll'

... Spontaneous resolution of fetal ascites secondary to gastrointestinal abnormality Authors: Alison Wiles, MD1; Melissa Yannetti , OMS-IV2; Cheryl Dinglas, DO, FACOG 3 1. Mount Sinai South Nassau Hospital, Oceanside, NY. Electronic address: alisoncwiles@gmail.com. 2. Marian University College of Osteopathic Medicine, Indianapolis, IN. Electronic address: myannetti687@marian.edu 3. Mount Sinai South Nassau Hospital, Oceanside, NY. New York University Winthrop Hospital, New York University Long Island School of Medicine, Mineola, NY; Stony Brook University Hospital, Stony Brook, NY. Electronic address: cdinglas@gmail.com. Introduction Discussion Reported cases of isolated fetal ascites determined to be idiopathic have been shown to carry a favorable prognosis with frequent spontaneous resolution in utero (1,2,3). These cases generally reported better fetal outcomes with delivery of normal neonates as compared to cases with associated conditions such as gastrointestinal and genitourinary abnonnalities, intrauterine infections, and overlapping cases with hydrops (1). No existing reports of antenatally resolving fetal ascites with a discovered gastrointestinal anomaly describe concurrent resolution of the underlying abnormality wilhoul surgical correction or postpartum regression with medical management In this case, fetal ascites was prenatally diagnosed on ultrasound at 32 weeks secondary to a suspeded gastrointestinal abnormality and was found to have spontaneously resolved in utero with a normal neonatal course. Presentation of the Case A 33-year-old G3P1011 female presented for routine visit at 32 weeks and was found to have a diagnosis of moderate fetal ascites by ultrasound examination with a complex mass noted in the fetal abdomen near the small bowel measuring 5.2 x 3.6 cm. See Figures 1a and 1b. There were no pleural effusions, pericardia! effusion or skin edema noted. Both umbilical artery and middle cerebral artery Doppler studies were also noted to be normal. The fetus was noted to be large for gestational age with an estimated fetal weight of 2600 grams (5Ibs12oz, >90% for gestational age) however this was largely driven by the fetal abdominal circumference which was measuring 5 weeks ahead al 33.24cm due to the ascites. Her prenatal course had been uncomplicated previously with low risk prenatal screening and an unremarkable Level II anatomy ultrasound at 20 weeks. Her only medical history included a liver mass diagnosed in 2012 by a hepatologist. Her prenatal oourse otherwise became complicated by gestational diabeles but was controlled on insulin. Due to the concern for possible fetal gastrointestinal (GI) abnormality and potential developing hydrops, she received a full course of betamelhasone and lab studies were sent. TORCH liters and Parvovirus liters were negative based on prenatal records. The patient's blood type was A positive. Fetal cardiac anatomy was noted to be normal. The patient was counseled on possible genetic etiology however she had low risk first and seoond trimester screening and amniocentesis was deferred due to her advanced gestational age. For further evaluation of the previously noted complex intrabdominal mass, a fetal MRI was performed which revealed traces of fetal asciles and mild subcutaneous edema. A space-occupying lesion of a loculated area of ascites was noted under the area of the gallbladder on the left side with concern for ruptured gallbladder versus ruptured bowel. On follow up ultrasound, the complex mass appeared as an area of echogenic bowel and was noted lo be 5.4 x 2.7 cm al 33 weeks and then 2.2 x 1.97 cm at 34 weeks and only trace ascites was now seen. The liver appeared enlarged and the gallbladder was difficult to visualize. At 35 weeks, the ascites appeared to have resolved. The complex abdominal mass near the small bowel continued lo measure smaller. (Figure 2) At 37 weeks, both the fetal abdominal mass and ascites had resolved. (Figure 3) During weekly visits no fetal hydrops was noted, doppler studies remained normal, and antenatal fetal testing was reassuring. The patient presented to labor and delivery at 39 weeks for scheduled repeat cesarean section and subsequently delivered a viable female infant weighing 3515 grams with APGAR scores of 9 and 9 at 1 and 5 minutes. Neonatal abdominal ultrasound was unremarkable. The neonate had no issues with feeding and normal urinary and bowel patterns noted and both the patient and neonate were discharged home on hospital day 3. One of the most commonly reported gastrointestinal abnormalities causing fetal asciles is meconium peritonitis (MP) which develops secondary lo bowel obstruction and perforation in ulero (5). Occurring in 3.7 out of 10,000 live births (5), fetal ascites is the most commonly occurring sonographic finding of MP, in some reports as high as 93.3% of cases (6), making it a likely explanation behind the felal ascites in our case. Intra-abdominal calcifications, a frequent find in MP, as well as dilaled bowel loops have been shown lo persist in reported cases in which fetal ascites spontaneously resolve (1). Our case was shown to have resolution of both the intra-abdominal mass and ascites by 37 weeks. In 91.9% of cases in a retrospeclive study of neonates with a prenatal diagnosis of MP (n=37), surgical correction was required (5). In one report of thirty-four neonates, the most frequent anomaly found was volvulus of the GI tract (5). Severity, one of the prognostic factors of isolated fetal ascites, has been determined to be negatively correlated lo gestational age of onset, the most important factor in predicting outcomes in isolated fetal ascites (10). In a retrospective review by Nose et al, 86% of patients with ascites detected after 30 weeks had regression without surgical intervenlion while 80% of those detected before 30 weeks required eventual surgery. In our case, the asciles and associated abnormality was detected at 32 weeks and was subjectively determined to be moderate in severity. Conclusion Since spontaneous resolution is uncommon, antenatal detection of fetal ascites and GI abnormalities requires further monitoring for worsening or changing signs that may require intervention. The data supports that late gestational onset is associated with a more mild condition of isolated fetal asciles and carries a more favorable prognosis, while onset before 24 weeks or association with fetal hydrops carries a high mortality rate. Isolated fetal ascites even wilh associated gastrointestinal abnormality can have good neonatal outcomes with late gestational onset and in utero spontaneous resolution. References '""""c __ .., ,,. ____ ., ____ o...-...,..,~..,.... ,__,_.1.~---..----~ -,,. .~~-- - - - H .._,,._..,_~---A-H____ ,,_..,.... _,__ k_:I0;!<~1,10, ;g~~~=-======--~=:~ ,----~-,--- .. - , ..- ..,.z.....0.-1--11. _ _,.. _ _ _ .. , _ _ _,. _ _ _ _ _~ - - - -.... - w,J..1,-111/M ,::-;,...-..'7,!....,oc,._,., ____,_-'-i .,._.. _AC-~-OIW.,...~-i,_ld')110.1r, _ _ _ _ _ _,. _________" - f .W.-l ..,,.A_U_IIO.--,lklol. . : ~ t - N _l\,..__ OI t ...4,,.._T ,._ _ _ _ _ _ _ _ _ _l _ _ _ _ _ . _ . ,_ _ X1v-.::,1.,,._  ...

... BAcKGROUND WRITTEN VISITATION POLICIES METHODS All policies included: 4-5 hours blocks of visitation time Over 1.25 million people reside in nursing facilities in the United A survey created using RE0Cap was sent out electronically to a convenient sample of 39 Indiana nursing facilities on July 7th, 2020 States Nursing facilities have reported 268,707 confirmed cases of COVID- Visit duration varying 15-25 minutes Required family members to register for a visitation spot by calling the facility and one provided an online registration option Mostly heterogeneity in policies related to minor visitors 2/5 policies requested that visitors stay in cars while being screened for symptoms and signing in 2/5 policies made mention of prioritizing residents for visits, specifically and was closed on July 17'', 2020 19 and 61,765 COVID-19 deat hs as of the week of November 2, 2020' * Indiana was one of the first states to implement guidance to reopen nursing facility visitation, starting with outdoor visits in March of 2020 Without family visits or other outside social contacts, residents may Questions included start of visitation date, issues encountered with outdoor visitation, concerns about visitation, and implementation of written visitation policies were obtained via check boxed options those experiencing loneliness or psychosocial distress - become lonely, despondent, and have feelings of abandonment which may lead to depression, weight loss, and worsened behavioral 1/S policies requested visitors bring their own lawn chairs for visitation CoNCERNS ABOUT INDOOR VISITATION ~ symptoms of dementia1 Visitors or residents not following masking or social distancing policy Decreased ability to social distance in smaller spaces Potential to run out of needed supplies Concerns about indoor visitation were obtained through an open ., ended question Need for additional staff particularly for weekend/evening hours - t - t "' DISCUSSION SURVEY RESULTS Early experiences and facility-level policies provide insight into some variation in operational practices regarding outdoor visitation We highlight some ongoing concerns of facility administrative and clinical leaders seeking to implement these new policies 15/39 of facilities responded 5 facilities provided written visitation policies 4 facilities provided photos of visitation 14/15 reported start dates ranging from June 3-June 26 The most frequently reported issues were: Ensuring adequate staffing during visitation Must .awrop,i.11ety follow ~ i a l e ~ I dtst.lndng Mid Nnd hygictle ....~ my in design.,1cd foKility W tions Visitation ~Id be restricted to children 12 yeaBol .gc01 o&der. 50rnee,,:aption5, Oik:lren d any age Me pc.'rfflittc.>d to visit ' Otiklren unde, 2 ate rl()t required lO wear a ~ ' t,,,W Mgn in and provide corutt infomvtion t,,W be screened fats~ a n d ~ ol d to clean visital.00 art\l ~ r e Pf>E and alcohol ~ hand nb must be ll.fJPlied 10 residenis Ouldoor visitation space should allow kw ptoptf soci.11d~ncing d 6 fl BNUltcian and barber SffVices am pmnitted in facililits Facililil5 1hat are ncx undl!t ITSlriction due to new facility~ d CCM0-19 mtai allow owtoor vis-~tion and IN)' start offering indoor visitation facilil-<.'S must offer al le.l:St four hooB ot 'mi~tion ~ily including evening and ....~ 1his an be a mixture ol OIAdoot and indoor visill~ionl Despite logistical challenges and concerns about increased exposure to the virus, strategies to promote visitation for residents in long term care facilities must remain an urgent priority. UTERATURE CITED I %ie.al ..._...., of "'1.IOffihlt1C.., ~N--.M"1liU. l H.flttp,;J/.-- ~. .J~-..-1t10~/......... ,ol_rii,. fd l ' ( , . ! l - . 4.c(JfUd~p,111,JO:NI. 1 o:,,a,.19r-Mwigi..o.... O.taol0..-..C.W..-lht.cmo.ll""'Mll>/ / 6 . N s . ~ l 9 - N ' - r i !. . 0.IU./llbfl ..,._ "'Nlhld lOJO. Acc1* ....... i,.1G10 l . G,a,d.--W,!.l.>-0,1Ji5kYN_n,..c....,....,,,..,Mllllha ltillht<>IN Bt.rlylnlAI. . 1.,.,e-._J'9Soc/lloJ,,cy. H>J0,11(, $)JU>-31S..OOl l0..lOl!O,'t:119$'J00.20lO,t"l'S(l1,.I,) "-""""'"'"""uw,,,'".i.... ui~c-..,,,.,ait....~ 10 w - . . o , , ~ ~. ..., , ~... bw,,o,- ~1Nottirll~I.Nflt.lll~1r"--.""~mo AUtolollN-l"'IO-N'7.1GlO. ~ M.tsl have lhe ability to tr'1Shions safety from 1heir room toa.n OU1door visltltion Mu~ beKteenedfot s.igmand~of (D\,1[).19 priot IOvisil Prioriliution fot visi~rion should bl>: far tt!SidMI$ with d ~ that ca~ kodon progres.sl...e o.:ignitive dccline1d rtsidcncs ~ n g Scdingsol~iness for due who are ,ble should wear a f.Jce m,sk during visiYtion /t. ~vefacili1il5fot,ou1ineand Wt!hNlthatevisits. 'Ttw.Me MC -lddolio,u to lhe t5011 ,uicktonrs -ldded hit,, 17'11\. 2020, whk.11 w.n .,,.,.. lhe ~loM':'f'WUC:lli:IRd N(fllln,,(.Cool.J.ltl,;l,._,IOPffllt'IC McoWNl -,OUMctllo.,._.obol.lMnl,Choll!!.YalUltal.lNIOMWp(Jlill)Uo. ll'\e-1i'!loNl1010..-.C-ct11<11IIINo....,bw7, 1010, 'IIICC......,rl. Oni,, l l ,.,,... ......,.11o..._is,,...... hl , u1M1f~-- Daoil.Hlkwl..l'\.Clflll..o1010.At~L//w- ---=MLfCN/f'-lf't_CDV\'Nl~lOOll'l)UOTQdri;,UOCNikl,tl,ttY,,JOf,.1t,.J0"'1i.ll'\e-~ 1010, lo{OWH A~C\d'I II,. 1010. I..CMoou......._..p.hllp,JJww,.,a,...,,.....,._ft-fJ"'df,-.Jl.'t_COVID l . _ 1 , t d ~ ~ . 1 0 . p , N.f'~~d, 10.J0Acce.wi""Pnl,JOJO. , s.cc,.-s.c.aro,,-..s,mn O!yo:Cofflm._..:_tift~HUNhooNCN!HH~dowofl.cMf . . ~--UUff'..,,,._l ... lO fM'611_._..... ~ - 1 1 - . C ,.a>IIUoU. "'-bllhlo10l0 ~SSGIII No.w>'INf7, :IO:NI.  ...

... RESULTS The Role of Notum in Bone's Response to Mechanical Loading and Aging Norum express,on 1ncreasu ,n aged bone A) Osteoporosis is a silent, dangerous pathology frequently undiagnosed until patients experience a major fracture. B-adin B) J., About 1 in 2 women and 1 in 4 men ages 50 and above will experience bone fractures due to osteoporosis. L ~ - HYPOTHESIS Notum expression is affected by mechanical loading and aging. y. . . . "' SUMMARY Recently, inhibition or absence of Notum led to increased endocortical bone formation and thickness via osteoblast activity in a mouse model. ~ Figure 3 A) Whole bone samples were taken from differen1 aged mice, prolein extJacted and evaluated by Western blot 'Embfyo.~ (embl'yonic) sample age: embryonic week 12. "Young samples 1 week, 4 weeks, 8 weeks. 'Old~ samples: 15 weeks, 35 weeks, S5 weeks. B) The software prog;ram lma9eJ was used to quanlify Notum and B-ac1in levels (~p

... Racial & Ethnic Disparities in Pain Analgesia Administration ,~:: in the Emergency Department Lubaba Haque, B.S, Elizabeth Amundson, B.S. Background Results What Can We Do as Healthcare Providers? Healthcare disparities among different racial and ethnic groups are prevalent across the United States and worldwide. Healthcare provision may differ among racial and ethnic minorities, socioeconomic statuses, and insurance coverages. In the subspecialties of emergency medicine and trauma care, these differences may become more apparent as several integral aspects of healthcare are addressed across an incredibly diverse patient population. Pain medication administration is a specific area of emergency medicine and trauma care where discrepancies have been unveiled. Multiple studies have determined that the treatment of acute, subacute, and chronic pain may vary widely depending on racial group, with some minorities receiving pain management and control that is less than adequate. A review of 18 articles that explored racial and ethnic discrimination based on analgesic prescriptions and administration in the emergency department (ED) demonstrated: Providers can try to recognize their own implicit biases: recognizing biases can help raise awareness of how providers tend to interact with certain populations and may allow providers to help prevent any negative interaction from the start. There are several resources on understanding and testing for implicit biases, such as Project Implicit from Harvard (https://implicit.harvard.edu/implicitltakeatest.html). Inequalities still exist at the patient and hospital level, although they have begun decreasing overtime. 1--- Attend hospital-wide implicit bias and cultural competency trainings: trainings centered on cultural competency and implicit bias can help providers foster a deeper understanding of racial and ethnic inequities in the hospital setting, as well as increase empathy for patients from all walks of life. There were several notable discrepancies in analgesia administration and prescription based on the chief complaint. 1--- Methods A review of the literature was performed using the PubMed database to identify studies that have focused on the disparities and differences in pain management among racial and ethnic minorities in an emergency care setting. , ' 1--- Recognize cognitive stressors that may exacerbate biases: overcrowding and patient load in the Emergency Department may contribute to burnout and an increase in unsatisfactory patient encounters. Confronting and acknowledging the stressor may help providers become more conscious about how they are feeling and may help in taking a step back to assess their behavior. The pattern of analgesic administration for the treatment of headaches, pediatric long bone fractures, toothaches, abdominal pain, and back pain demonstrated that white patients are more likely to receive opiate analgesics, while Black and Hispanic patients are less likely to receive opiates regardless of complaint severity. 1--- Key search phrases included: (emergency medicine) AND (pain)) AND (race)) AND (ethnicity)) AND (disparities) Limiting the PubMed search to English, humans, works from 15 years prior, journal articles , meta-analyses, randomized controlled trials, and systematic reviews yielded 59 relevant results. After reviewing the content for these papers, 18 best met the criteria and were selected for inclusion. ' / Nonwhite patients had to wait substantially longer to receive opiate medication for abdominal and back pain. Constant reflection and acceptance of feedback: providers must be willing to reflect on their behaviors towards patients during encounters. They must also be willing to accept feedback from peers or supervising staff. The ability to do so raises awareness and allows correction of their actions in the future.  ...

... Discussion Introduction These results from a small private surgical practice demonstrate that patients find communication with their physician via mobile The ability to communicate with patients effectively continues to be a major hinderance for physicians and physician offices1 Coordinating care via conventional telecommunication, involving making calls to a healthcare facility or call-center for appointments and follow-up. is often fraught with the difficulties of long wait times. which in tum discourages patients' confidence in obtaining timely and appropriate care. Despite this. the prevalence of call centers in medical practices is predicted to texting to be superior to the conventional method of phone calls to the physicians office. These results were apparent despite the predominance of older respondents induded in this study. which challenges conventional notions that modern technological innovations may be too complicated or inaccessible to this population of patients. However. a discrepancy between those who perceived the quality of care with the app to be comparable or superior to conventional telecommunication (97%). compared to those who would overall prefer the mobile app over calling the office (86%) may signify the momentum of conventional telecommunication making adoption of contemporary technology slower. increase within the next decade2 The advent of numerous technologlc advancements and software solutions have offered opportunities to enhance the accessibility of healthcare providers with their patients. Specifically, multiple mobife device "apps" have sprouted in the healthcare field, specifically designed to be HIPPA compliant and utilized by The impact of effective communication using Klara is also reflected in the 9% of patients who were able to avoid an unnecessary visit to the ED. Patient complaints can be viewed by the entire care team assigned to a patient in real time, and allows providers). Various EMR-linked patient portal applications nave shown to be well received and helpful in avoiding unnecessary ER and office visits-4. While many of these systems allow for updates to be posted on patient's computer or mobile devices, research into the effectiveness and practicality of smartphone exclusive triaging of benign. non-urgent symptoms away from the ED. The impact of this finding. and of this new technology. may potentially reduce healthcare costs and the liberate emergency departments. applications. utilizing direct-to-provider texting features. is lacking, Limitations to this study indude its small sample size. limited demographic information, limited external validity. and lack of a controlled comparator group. An additional source of bias was We investigated patient preference using a smartphone, HIPPA compliant healthcare texting app, compared to conventional telecommunication with the office. in perceived quality of care. as that onJy those with smartphones were enrolled in this study, potentialty ske'-Ning patient preference toward comfort and familiarity with mobile apps. Finally. a low response rate (<30%%) potentiates selection bias and reduces the internal validity of this study. Additional larger cohort studies that capture a larger proportion of candidate responses. and that introduces more expansive demographic information are needed to validate the results of this study. well as surveyed the impact that these interfaces have on preventing unwarranted ER visits. Methods This study utilized a retrospective review from a single privatepractice surgeon specializing in hernia repair in Indianapolis, Indiana. Patients with access to a smart phone \A/ho received care between July 2017- March 2020 were offered care with the direct-to-provider texting healthcare app. Klara. References Results 1he Klara patient communication app allows for direct-to- provider text messaging. developed in 2016 An anonymous. depersonalized Qualtrics link was distributed to all patients with insb'\Jctions to complete an online survey, assessing satisfaction and preference using the app compared to their cumulative historic experience calling physician offices. Patients were asked if a concern for needing an ER visit ever occurred during their care. and how using the app influenced their decision Patient demographic information included a survey of age Surveys were submitted in March 2020 to the entirety of the private practice patient registry via email, as weU as through the healthcare texting app, cumulating to 320 patients. 90 patients completed the entirety of the survey at 9 months Age demographics were recorded (Table 1). median age range 50-60 years old, with the highest category of respondents between 60-70 years old Chart 1 demonstrates 97% of respondents felt using the app was non-inferior to conventional modes of telecommunication A majority (75%) of patients experienced an overall improved quality of care 86% of patients prefered using the app over calling the office when needing to communicate with their physician While 84% of patients never felt the need to seek attention in an emergency department 9% of respondents had an unnecessary ED visit avoided after consulting their physician through Klara first 1. Rictiard$ T. Chasm$ in commi.Hlication. BMJ 1990; 301: 1407- 1408. 2. Griffith. Kevin & DAVIES. Ml & Pia <, Steven & Pl'flltke. Juha. {20191. Ca" cllf'ltcr pcrlo,rn~ aff.cts P1tient pe,,eeptlons of -ess and sotisfa~on. Amtrican Jown~ of Mana9lt(I Cant. 25. 282-287. 3. l(ashga,yA, Alsoeairnani R, Mosli M, Fata; S. The role of mobile devices ii\ doctor-patiem communication: A systematic riRVlew and mttaanalysit.. J Telemtd Tetecare. 2017 Sep 4. Graham TAD, Ali S, Avdagovsu M. Ballf!NNnn M. Effects of a W Cl:b BIHd Patient Portal on Patient Satisfaction and Misnd Ai;>pc,inunent RatH: Survey Study. J Med Internet Ru. 2020:22(S):el79SS. Publi$hed 2020 Milly 19. doi:10.2196117955 Acknowledgements We would like to thank the Indiana Hernia Center for supporting this presentation.  ...

... Mechanisms of Bone Loss in Space Kendal Flowerdew, Dr. Fei Wei, Dr. Melanie Coathup Introduction Tht: uniqut: cond.ition11 of microgra'"ity a nd racliation t:xpoaurt: in 1pact havt: a 1ubatant.ial impact on human ti1.11u@ function; ruulting in txtzeme bone 1011. The c oal of thit projtct it to 1p1.thuin the current knowledce on bone lou in , pace for UH in future reaearoh. Thnt: ia cl@a.r @vidt:nct:, l:,aat:d on pa1t HH&rd1, that microgravity, co1mic radiation, Ou.id Oow, and. wtchanotrantduction i.n.flutnct bone function durin:: apact travel and ruult in ai(IWlcant 1011. Howeve~ t.heN ia a need ior future r uearcl:1. on how t.heae fact.ore relate to each otbu a.nd th.Mr collt:cti--.-., inBu(lmct: on nu,ch.ani.am.a 0 bont: recm.ration and repair. In addition, thut: it a nud for more ruurch on potentil 1olution1 to pttvent the hone Ion aeen durin:: apace uavt:l. Konnal Mechanisms of Bone Re11:eneration and Repair .Achiflved through the action of ouohluu, oeuiocluu. o,uocytu, and bon.t l.inin.c cella 01teocytea detect bont: dam& to bone and i::nal thia to bone lining cell, "; factora, auch PGE2, PGI2, I\O, and IGF-1 Bone lining ceU... rt:cogniu artd respond by recrui.cing oauoclan pr.cunon t o the 1ite of dam:- Oneoclut precur1on maturation mediated by R.ANK-L Oauocluu digf!H hone tlirough ll!xcrH1on of acid that degradH hydtoxyapatiu Unduco apoptoaia- Wtiated by 01teoprott11"rin (OPG) Oeuohlaeu rtcruited to area of newly dicened bone by -e;rowtl1. faeto,o, IGF-1, IGF-II, TGF~~ nd TGF~2 01teohla1ta depotit oateoid in cavity mineraliud to form new hone Combatinc Fluid Flow Effe<:t1 Biapho1phonate: inhibit oneodut activity Inu.rmi.tunt CompNaaion: im.provu Mood flow to affecud limb miR-33-ip Supplemtntation: promotu 01teobla1t diffuentiation mLIPUS: promote 01teoblaat prolife.ration Comhatin&" Radiation Effecu A.mifoni.ne: proteeu cellt from DNA damage cauud br radiation Antioxidant Suppleme.otation: prot1:cu acai.nat reactive oxycn Effects of Fluid Flow and llechanotransduction Mec:buiotran.sdu.c:tion and F luid Flow lltthanotran.aduction: p:rocu, of taking mtthanical e:nugy and CODVt:rtinc it into electric&l e.nera and biochemical icnal& When bone it bent or comprueed, a preuun cradient forcu Ouid out of the area of train Fluid and charge movement crutea a 1truming pounti&l that alten the electrical environment of the aurroundinc bone cdl, and activatH aeve.ral aecondary ev1:nU, leadin: to the R1orption and formation of ne;w bone; in the damaged uu ,elocity of th inteutitial Ouid mo,.ment it thouc;ht to play a key role in activatin& aurrour.idin.c eel.I, when bone it under 1treH Cytoskeldon's R o le io Mec:banotran.sdud.ion Cyto1keletoD: network 0 actin, microtubulea, and intermediate ilamenu, which provid~ 1bap and stability to ceU. Actin fi.l.amenta within cell.a HnH mechanical force a nd -cenera te contractile: a nd protrul i'-'-e forcea lntumuliate f'ilamenu urvit as aenaor, of mechanical force direction and 1tren~ C}-to1kelet on reactl to changH in fluid , he:ar 1tre11- a nd b u been lin.lr.e:d to bone cell reaponu to loading F lu.id Flow &1:1.d Bone Lou in Space :llicrocravity reducea fluJd flow within bone by two mearu-: cephalad fluid ehifu a nd loH of me:chanical loacling Lou of the gra,..itat.ional prHIUH gradie:nt increau1 prHauu in the upper body and decrun1 preu un in the lower body Bone experieneea unloadin: dlll'ing apace travel becau1e it no )ongu bur the: we:ight of t.he: uuonaut DtcruH i.n Ouid veloci.ty and lou of loadin1-induced Oow of interatitial fluid tlu-ou: h the lac:una-canalicular net,,ork decrenH tlle mechano1eneitivity of t he hone eeU. Oateocyt.u undngo apopt.otis due tot.he: lack of fluid ehur fore 1timulation, reaultin:: in a reduction in hone man Unloadin: decreuu proliferation of 01teoblnt precunor cella and caueu rHietance:- to para t.hyroid hormone (PTH) and lneulin-1.i.ke; c ro...,'t.h factor type l (IG-F-1) in oeuoprogit.nitor cells L-type calcium channel. in 01teohlasu are inhibited under microgravity, block.in: their major muna of initiating bone formation Unloading cawed on.oeyt.ic diauae leading to reaorption Under microcravity condition.1, thi1 uaemhly of the cyto1keleton ia alure:-d bec:auee t.hey d-o not ha,..e th g ra,..ity v.-ct.or u a guide: for c rowt.h Under n1forocravity condition.1, cell c rowd1 ia bloclcd either th Gl phan or G2/M checkpoint. due to C:)'t.oekeletal che,n:ea Effects of Cosmic Radiation Ccmnic: Radiation Radiation eDvironment in epace; is a mix of galactic coemic radiation, eolar particlea, and ceomarnetically trapped particlu G letic coemie radiation (GCR) i.e. "bac"-crouud" radiation originating from ouuide the eolar , y 1um~ but mo,tly from ";tlUn t.l,;e Milky Way galaxy Sola.r particlH (SPE) come from ,olar Ouea and coronal maH ejection,. when lar,e ma11ea are randomly ejected from the eun Geomagnetically trappe:d particlH are protone and ele:ctron.1 with.in the eeomapetic fltld layer, wh.ich it tht marntic field ,urroundinc the Earth As utronautl mo,re further away from the Earth, the radiation expoaurt ,hifu from monly geomagne:tically trappitd particlu to GCRand SPE When GCR nd SPE particles interact with epacecraft ehieldinc, the:y can create ucondary radiation a nd incru1e the: potency of hu,.y ion irradiation CellWu R tiponse to Radi.ation The body re1pouded to radiation through inOammation, DNA damage repair, and reluu of ROS aca,.~ger1 Inflammation ia initiated by activation of ltrtHaen,iti,.t kinau,, proinflammatory tranecription fac:ton, and upreplation of proi.nflammatory cytokine production. DNA repair mechaniam,: bau e:xcieion repair, nucle:otide: exciaion repair, mi.match repair, homolocou, recombinatio~ and non homolorou1 end joinineRaliationlnduced Bon Loss iD S pau Radiation cauu1 o,ttoblaat de:-ficiency, o, uocyte dutzu.ctiou, fibro1ia of bone marrow, decruaed BMSC, , and tranaient increaa.H in oeuoclaeu R e:duct.ion of 01uohlaeu occur, almoat immediately after e;xpoaurt to radiation Osteocla,u inereaae in number and activity when expoud to radiation Solar particlH and galactic: c:o,mic radiatioD negaU"'ely affect hematopoietic aum cell, (HSC). both directly and indirtttly Direct: ge.netic change.a and alteration.a in cytokine expreuion, ruulting in dtcreaeed eell output from thut progenitor c:tlla Indinct: ..Biological Bytander Effect" Meunchpnal i tem celli preferentially differentiate into adipocyt.ea inauad of myocyu.ii, oneoblaau, neuron.a, and chondrocytH Coa.mic radiation ia belie:ved to se-naitize: bone to the e:ff.-cu of mi.crocravity and their combined effecu are what lud to injury nd bone lo e ,-:perienced in epace  ...

... Abstract Previous studies indicate that common fibular, tibial, and radial skin sympathetic nerve activity (SSNA) increases with physical stress in an exercise intensity-dependent manner but abates during ischemia when class Ill & IV muscle afferents are stimulated without the engagement of the motor cortex. It is currently unknown if these peripheral nerve responses are similar to nerves of the face. Rosacea, a fascial fiushing disorder, results in substantially higher physical and mental stress-induced increases in SSNA, but it is unknown if this is modifiable. We hypothesize that physical stress increases supraorbital SSNA in an intensitydependent manner. Furthermore, we hypothesize that post-exercise muscle ischemia (PEMI) will not modulate supraorbital SSNA Nine healthy subjects (5M/ 4F) participated in a series of physical stressors known to be symptom-triggering in individuals with rosacea. Forehead SSNA (supraorbital microneurography) was measured during handgrip exercise for 1 minute at 15%, 30%, and 45% of their maximum hand grip strength. Additionally, 2 minutes of hand grip at 30% of maximum, followed by 2 minutes of PEMI (upper-arm arterial occlusion) were completed to assess the role of muscle afferents in the SSNA response. Skin blood fiow (laser-Doppler fiowmetry) and transepithelial water loss/sweat rate (TEWUSR; capacitance hygrometry) were measured on both the forehead and the ventral forearm during procedures. Heart rate (HR; ECG) and mean arterial pressure (MAP; finger photoplethysmography) were also recorded. All intensities of handgrip increased HR and MAP , and these responses were positivity correlated with intensity. Handgrip also increased SSNA, but there was no association with intensity. No changes in skin blood fiow or TEWUSR were observed across trials. PEMI maintained handgrip-induced elevations of MAP and SSNA, albeit at a reduced magnitude compared to baseline. Contrary to our hypothesis , physical stress did not increase supraorbital SSNA in an intensity-dependent manner (15% , 30% , and 45% of maximum handgrip strength). Furthermore, unlike peripheral SSNA which increases during physical stress but abates during PEMI , these data indicate that ischemia or ischemic pain increases supraorbital SSNA These data imply that supraorbital SSNA differs in control and regulation from peripheral nerves, and these differences could potentially account for altered supraorbital SSNA results observed in individuals with rosacea Methods Human subjects: 9 healthy subjects (4 females, 5 males) completed the study. A medical history and vital signs were used to screen all participants for health Instrumentation/Measurements: Supraorbital SSNA was measured by inserting a custom sterile tungsten microneurography electrode (impedance 2 MO, shaft diameter 0.2 mm; FHC, Bowdoin , ME) through the skin without local anesthesia (Figure 2 & 3). Capacitance hygrometry capsules (with custom ventilated chambers perfused with N2 ) measured sweat rate and TEWL while laser-Doppler fiowmetry (Moor Instruments, Wilmington , DE) assessed skin blood fiow. Heart rate was calculated via 2-lead ECG (CWE) and beat-bybeat arterial blood pressure (Finapres Medical Systems, Amsterdam, The Netherlands) was measured by finger photoplethysmography. A skin thermistor (YSI , Yellow Springs , OH) measured skin temperature It is estimated that rosacea affects 16 million Americans' . This disease can be very costly and drastically reduce quality of life 2 3 . The etiology of rosacea is currently unknown , though physical stress can trigger symptoms which include facial fiushing 4 5 . Physical stress increases skin sympathetic outlaw", which can be quantified directly via postganglionic SSNA in several superficial nerves. Previous studies indicate that common fibular, tibial , and radial SSNA increases with physical stress in an exercise intensity-dependent manner but abates during ischemia when class Ill & IV muscle afferents are stimulated without the engagement of the motor cortex'' It is currently unknown if these peripheral nerve responses are similar to nerves of the face. Rosacea results in substantially higher physical and mental stress-induced increases in SSNA 9 , but it is unknown if this is modifiable Baseline Figure 1: Skin sympathetic neurogram obtained via microneurography Hypothesis: We hypothesize that physical stress increases supraorbital SSNA in an intensitydependent manner. Furthermore, we hypothesize that post-exercise muscle ischemia {PEMI) will not modulate supraorbital SSNA. Table 1: Heart rate and arterial blood pressure changes during handgrip protocol. Values are reported in the table as an absolute change from each protocol's baseline, where a {+) indicates an increase and{-) a decrease. Protocol #1 Protocol #2 Base/I HG 15% 30% 45% Base 2 min HG HR (bpm) 531 +11 +62 +71 552 +32 PEMI -21 MAP(mmHg) 872 +81 +122 +112 902 +222 +121 SV (ml/beat) 922 -61 -92 -61 922 -162 -21 Skin blood fiow as indexed by CVC was greater in the forehead compared to the arm (608 vs. 406 fiux/mmHg , respectively). These site differences persisted but there were no significant differences were noted between protocol, treatment No differences between site, protocol , or treatment were noted for TEWL/Sweat rate I I I SSNA in Protocol #1 increased during IHG but this increase was not significantly different between 15, 30, and 45% of MVC (maximal responses range from 117-134%) change from baseline across the different grip efforts Figure 2: Supraorbital microneurography Introduction Results Figure 4: SSNA responses during Protocol #2. Figure 3: Supraorbital microneurography Protocol 1: SSNA was measured in the supraorbital nerve throughout the experiment Laser-Doppler fiow probes for skin blood fiow, ventilated capsules for TEWL/sweat rate, and a thermistor for skin temperature were placed within the typical area of supraorbital innervation on the contralateral forehead because ipsilateral sensory-related mechanoreceptive afferents could not be avoided. Laser-Doppler fiow probes and hygrometry capsules were also placed on the ventral forearm contralateral to the handgrip. The placement of the recording electrode within the nerve fascicle was verified until SSNA bursts were identified using previously established criteria 10 ,11 , which included 3: 1 signal-to-noise ratio; skin afferent recordings; nonpulse-synchronous SSNA induction by startle, inspiratory gasp , and handgrip; and no relation to chemorefiex or barorefiex perturbations. Baseline measurements were obtained , followed by the handgrip protocol. To induce physical stress, participants performed a series of isometric handgrip exercises. Participants performed maximal voluntary contractions while force was measured via compression dynamometry (Biopac Systems) to determine target submaximal forces of 15%, 30%, and 45%. Handgrip force feedback was provided via verbal cues. These tasks increase fibular SSNA in an effort-dependent manner that is not related to the amount of muscle mass involved 12 13 14 15 . Forehead SSNA was then measured during the handgrip exercises for 1 minute at 15% , 30% , and 45% Protocol 2: Following a similar set up to Protocol 1, subjects underwent training to determine target submaximal forces. Upper-arm arterial occlusion with a manually infiated blood pressure cuff created postexercise muscle ischemia (PEMI). 2 minutes of hand grip at 30% maximum followed by 2 minutes of PEMI were completed Data Analysis: Data were acquired at 1,000 Hz with the use of a data acquisition system and analyzed with commercially available software (Biopac Systems). Data are means SE unless otherwise noted Supraorbital SSNA was calculated as the integral of the integrated SSNA neurogram 16 , averaged in 30-s bins, normalized to baseline, and expressed as percent change from baseline. Normalization accounts for individual SSNA variation and electrode locations within the nerve. Cutaneous vascular conductance (CVC) as calculated as red blood cell fiux divided by mean arterial pressure (MAP). HR, cardiac output, MAP, CVC, and sweat rate were also averaged in 30-s bins. Group differences analyzed via RM ANOVA utilizing SNK post hoc analysis when significant main effects were observed Discussion There was a positive correlation with HR and MAP compared to handgrip intensity. Physical stress did not increase supraorbital SSNA in an intensity dependent manner (15%, 30%, and 45% of maximum handgrip strength). PEMI maintained handgrip-induced elevations of MAP, though at a reduced magnitude compared to baseline. Similarly, PEMI maintained elevations of SSNA. These data indicate that supraorbital SSNA differs in control and regulation from peripheral nerves. Unlike peripheral SSNA which increases during physical stress but abates during PEMI, these data indicate that ischemia or ischemic pain increases supraorbital SSNA. These differences could potentially account for altered supraorbital SSNA results observed in individuals with rosacea. Acknowledgements & References Laboratory funding is provided by NIH AR-069912. Authors wish to thank Hill Rom Simulation Center staff for their data collection assistance , and Dr. Kristen Metzler-Wilson for her editorial contributions and aid in experiments ml t 1. NlrnlalRoue.--""'(O..,e). hff .,,,.,..,,..., ., l. Al:..,,,B,~~?OA, f 11dcllarocto t aOOva 1JS tro1mon1 rrodoif . Br JOermo1,- 16J:719-725 J. n+<(m,gh '200ec 201:lo). 9 Betort fC , l.an11nicllAX,R,,dlkol,IA, A"g"t M. Wili'lgneH 10 ?Vo ne ro<>U 7: 73'.-7lll,201J I , l ., T-, l ., . .- , 0 . L., lo, I ., J rov, A. J ., 0 . - n , 0., I . - T. l . (Jt11). A1-1r - 1 , - ,,... .. , , _ , ""t , la . n~-- .,,._10 ,.,,.. *Ir _ _ _,_....,,11<1(J), 11Jt-11J7 Ooloa W, Ma1Nr'lll l!, Moa10 I A, Wol i. o--- , _10 - - . -la r.-.A ,._,_,_ 11 Ma1Nr1II IQ' ,M11i. "3,Moa10I A,T~M ! ,W1f . :.~: 1~:: .r~~,.,.:?:::.;.z:~~~~,~"7"-=-:n. .: .:::-:.~:.::=:: 12 ::~;;,:::~~~;;:~~; .~..... 5. 6. 7. 3. o.1~.... Ja,..--otot o,o.1o~.--1or, Tn1 . . , . , _., .... L, l 1- - L, . . _O,ZN, . . . A. C.Nu r- -t a 1f- 10 - AN el. ~ONNI . .. N 10e-ol0-1 o! roNNO llf J .: oala1n r o - lo- - 1,l"rol -Hr , re . cot 112: l lol-2, 1 2006' 1~e1\,.;~:- y - , T.~ ., . . ~e!\ : : " , ,,~. J.,l.:y,C. ~ -----1----,..,,...... !. V ~ ~ ~ !.';G s:-:~ t:.:o H1 1 1- ~ \ . J), ~ ~;:1- -10 N"Ye r " ' - 1 1 "-J,C. A.,I.Wl-,T.l. C-).Co- , 1- a , , . _10 Yr"'- 1 ,11(1), 1--1"4 , ,.,. , . . ., .-1 10 . . ., e rol 1braot 1 t - t -10 ...... . - la 1- --------1- 13 11 V10S g Sf, Scllerr.,. U,Vdor RG.St rnJlot ISY"l'Olhet n,,rve r11< Y"l"1~ I ,,..,.clod g slot oxor q 69: Z'&-.2311, 1991 15 - 16 T 1ca, l olor DI, c , , -11 ca, , _ 1 n e a - 1 , ..t ,.-..,,._1,_ , _. J,.,_,._,_,_ 1. : 1711- 17112; oot-rollir H IJ,._ ,0,,-0J,"-JCA. Oot laof alaa,,._1, _ ,rent l cooT,-o1 __. r " ' - 10 - . a c o . . JA.,,_,-11o 1 oor.-e,..., - ..,."":  ...

... Changes to Medical School Education Around the World in Response to the COVID-19 Pandemic c:J>)) Kelly Nixon1, Kristin Bredhold 1, Bhupal Bhetwal, Ph.D1, 2 1College of Medicine, Marian University, Indianapolis, IN 46222 2Department of Physiology and Introduction The COVID- 19 pandemic has created a Wlique situation for medical education worldwide as traditional medical training is not compatible with social distancing guidelines. Curriculums, content delivery, and procedures across medical schools and governing bodies worldwide had to rapidly change to alongside rapidly adapting guidelines to ensure continuity of education for the future physicians of the world. Objective Assess and compile responses to COVID-19 in medical education systems worldwide Present and compare strategies put in place by different states and countries Methods 61 articles regarding medical education in the time of COVID-19 were compiled from online literature databases (PubMed, etc) Articles were sorted based upon state, country, and pertinence to pre-clinical vs clinical years of medical training A qualitative literature review of the articles was then performed to assess changes in medical education and curriculum across the United States and worldwide. Biochemistry, Marian University, Indianapolis, IN 46222 Discussion With the exception of Singapore, which had pandemic preparedness plans in place due to previous experience with disease outbreaks, the undergraduate medical education systems of many countries around the world were not prepared for the changes brought on by a pandemic. As such, the global transition to online preclinical, and often clinical, medical education did not occur smoothly. In many COW1tries, instructors lacked experience utilizing online platforms for content presentation resulting in thL teed to create entirely new content rapidly. Even areas with previous utilization of online technologies saw issues with transitioning the previously in person aspects of the curriculum onto a virtual format. Further the relocation of many students back to their homes led to universal frustrations as scheduling problems arose due to students being spread across multiple time zones. Additionally, in areas such as Australia, New Zealand, and the United Kingdom, where students were medical students were enrolled in gross anatomy classes, new technologies had to be implemented in addition to the development of supplemental instruction methods in order to fully address presented topics. While the majority of the globe approached pre-clinical education with a transition to online education, nations were not as uniform when it came to students in the clinical years of medical education. For some nations such as Italy, rapid changes had to be made not only to continue medical education, but also to preserve the delivery of care to the population. In order to fill growing needs, Italy a.llowed for the early graduation of almost 10,000 senior medical students, an act that was followed by the United Kingdom, Turkey, and some schools in the United States. Similarly, Iran utilized medical students to assist with COVID response by aUo,ving them to practice under the direct supervision of physicians rather than graduating early. Australia allowed students to remain in the clinical setting to help with the increased burden on the medical field as long as they were not working directly with COVID patients and Mexico allowed for students to work with Social Services. By and large most other countries suspended clinical rotations, choosing to either postpone them until after the pandemic or provide virtual alternatives to in person rotations. Results Preclinical years: o Most countries transitioned all preclinical classroom training to a virtual fonnat. o This transition did not occur with the same level of case globally though as some countries were able to have rapid, uniform transitions due to previously constructed pandemic response plans, while others experienced difficulties due to a lack of planning, technology or logistics. Clinical years: o Different countries and regions responded with a variety of plans ranging from posrponing clinical rotations to the early graduation of final year students. o ln the United States. the AAMC and the Liaison Committee on Medical Education detennined tha1 students were nonessential workers and therefore made the decision 10 stop all direct medical s1udent-to-pa1ient contact Conclusion The COVID-19 pandemic significantly impacted medical schools worldwide as pre-clinical and clinical curriculum have largely transitioned to remote learning platforms. Pre-clinical student concerns to remote learning included both positive aspects, as related to increased schedule flexibility, ability to explore new learning resources, and time to focus on wellness, and negative aspects, as related to the loss of clinical experiences in the core curriculum, reduced impact of laboratory courses, and heightened feelings of anxiety and isolation. Clinical students noted similar opinions to the remote learning environment, with additional concerns regarding exposure to specific specialties, such as dermatology or surgery, and impact on future residency applications.  ...

... CBXS IS D OWNREGULATED IN A GGRESSIVE HNSCC SUMMARY """'"""' Head and neck squamous cell carcinomas (HNSCCs) have remained [] one of the common and lethal cancers around the wor1d. HNSCC rapidly spread via the lymphatics system, leading to a higher percentage of initial late-stage diagnoses and poor prognoses for patients. CBX5 is downregulated highly metastatic breast cancers and may repress metastatic phenotypes It is unclear what role is may have in HNSCC, or which specific functions of CBXS drive its antimetastatic role. .... We aim to map molecular changes to phenolypic expression in order to provide better diagnostic prognoses for different HNSCC cell types as well as possible pharmacologic targets for treatment. CBX5 Gene Expression & 13 "312 of 1 p 0.01i& I - Vasa.ilar figure 3. CO31 staintng of blood vessets of HNSCC primary tumors in mice, wtlich helped determine which HNSCC metastatic eel lines were vascular and avascul.v. BREAST CBXS- GFP C BX5 GAPOH - Angiolymphatic Invasion 60 p < 0.0001 f igure 2. Comparison of angiofymphatic: invasion between NO- c1nd NO+ p.c1tient,. The dnical sigmicc1nce suggest, that CAGAGGATGAGGAGGAGTATGTCATGGAGAAGGT1V22M-2 CAGAGGATGAGGAGGAGTATGTCATGGAGAAGGT, V22M-3 CAGAGGATGAGGAGGAGTATGTCATGGAGAAGGT1V22M4 GAAGAGAGACTGACATGGCATGCATATCCT 174 COLON Figure 1. HNSCC rates are on the d ecline overall as are many cancers, hO\vever, the survivability of HNSCC has not significantfy changed over time unlike other cancer subtypes. Template CAGAGGATGAGGAGGAGTATGTTGTGGAGAAGGT1 Sequence csxs CAGAGGAT--- GAGGAGTATGTCATGGAGAAGGT1V22M-l' GAAGAGAGACTGACAGCGCATGCATATCCT w A-l GAAGAGAGACTGACAGCGCATGCATATCCT w174A-2 GAAGAGAGACTGACAGCGCATGCATATCCT W174A4 ASSOCIATED WITH NEGATIVE TREATMENT OUTCOMES ORAL CBXS P OINT MUTATIONS Avucular HYPOTHESIS: Heterochromatin binding by CBXS, but not dimerization or ligand activation, is necessary to suppress in vitro metastasis in HNSCC cell lines. R EGIONA L M ETASTASIS SIGNIFICANTLY DECREASE S SURVIVAL AN D IS INTRODUCTION OF D ISSECTING CBX5 ---- Figure 4. The CAL27 and UMSCC178 cd lines are metastatic vascular and appear to have lower constitutive express.ion of CBXS than the HN12, and HN6 lines which are metastatic: avaseular F UN CTION THROUGH M UTATIONS l165E Disrupts homodimerization Figure 5. lnduc1tion of the V22M point mutation interrupts CBXS's ability to recognize the heterochromatin and bind to it. V22M-1 also had an addjtional unplanned mutation resulting in aa fr~meshift and rnultaanl tot,11 l