搜

... The item referenced in this repository content can be found by following the link on the descriptive page.  ...

... CLINICAL AND LABORATORY OBSERVATIONS Side Effects With a Focus on Lymphadenopathy Following COVID-19 Vaccination in Pediatric and AYA Oncology Patients Jennifer A. Belsky, DO, MS,* Whitney R. Carroll, MS2, Guang Xu, PhD, and Seethal A. Jacob, MD, MS* Summary: The Coronavirus Disease 2019 (COVID-19) pandemic led to the swift development of multiple vaccinations. Vaccine side effects were well-documented in the healthy adult cohort and included fever and lymphadenopathy, however, side effects in the pediatric immunocompromised population have not been reported. This retrospective study investigated vaccine-eligible children and adolescent young adult oncology patients 12 to 35 years old. We found uncommon, mild, and self-limiting side effects among pediatric cancer patients and survivors. This data will help guide pediatric and AYA oncologists in providing anticipatory guidance and serve as a guide to managing lymphadenopathy as a potential confounder of malignancy. Key Words: pediatric oncology, supportive care, COVID-19, vaccination (J Pediatr Hematol Oncol 2023;45:8890) BACKGROUND The Coronavirus Disease 2019 (COVID-19) pandemic saw rapid availability of multiple vaccines approved for use in adults and children 12 years old or older.1 Of importance, in healthy adults, data from all 3 available vaccines (PzerBioNTech, Moderna, and Johnson & Johnson (J&J) demonstrated concern for lymphadenopathy (0.4-8.4%) and fever (4.7%), which have been attributed to locally activated antigens migrating to draining lymph nodes.24 Similar rates have been reported in children 12 years and older.4 Adenopathy was reported as an unsolicited event in 1.1% of patients receiving the Moderna vaccine. Axillary swelling or tenderness was listed separately and occurred in up to 16.0% of patients 18 to 64 years of age and up to 8.4% of patients over 65 years of age (vs. 4.3% and 2.5% in the corresponding placebo groups, respectively). Patients receiving the Pzer-BioNTech vaccine had a self-reported rate of adenopathy of 0.3%. Clinically, axillary swelling or Received for publication December 14, 2021; accepted December 13, 2022. From the *Department of Pediatrics, Indiana University School of Medicine; Division of Pediatric Hematology Oncology, Riley Hospital for Children; Division of Pediatrics, Indiana University College of Medicine; and Marian University College of Osteopathic Medicine, Indianapolis, IN. Research reported in this publication was supported by the National Heart, Lung, and Blood Institute of the National Institutes of Health under Award Number K23HL143162. The content is solely the responsibility of the authors and does not necessarily represent the ofcial views of the National Institutes of Health. The authors declare no conict of interest. Reprints: Jennifer A. Belsky, DO, Division of Pediatric Hematology Oncology, Riley Hospital for Children, 705 Riley Hospital Drive, Indianapolis, IN 46202 (e-mail: jbelsky@iu.edu). Copyright 2023 Wolters Kluwer Health, Inc. All rights reserved. DOI: 10.1097/MPH.0000000000002621 adenopathy manifested within 2 to 4 days after either dose and lasted on average 1 to 2 days (Moderna) and 10 days (Pzer-BioNTech). Among all study vaccine recipients in the Pzer-BioNTech group, 4.7% of patients 18 to 55 years old experienced a fever 38C. In addition, myocarditis and pericarditis have been observed.4,5 With the overwhelmingly positive protective effects of the vaccine, there are some unintended side effects and hesitancies in the general population, as well as the immunocompromised patient population. It remains unclear what proportion of oncology patients will experience a vaccine side effect, including adenopathy on imaging, whether the rate of adenopathy will vary between different doses and unique vaccines, the size, number, laterality, and morphology of affected lymph nodes, or how long nodes will remain abnormal in an appearance on various imaging modalities. Findings may be present for a longer period on higher sensitivity imaging such as 18FDG PET (PET), in which inammatory activity may be detected even in nonenlarged nodes. In addition, febrile neutropenia is a serious complication for patients on therapy that has the potential for hospitalizations, intravenous antibiotic administration, and burden for patients and hospitals. To best counsel families on expectations surrounding the vaccine, data regarding the risk of side effects must be available. Considering these preliminary ndings, it is unknown if children and adolescents and young adults (AYA) with cancer and altered immune function will have similar side effects. This retrospective study aimed to explore and describe the side effects of the COVID-19 vaccine in the pediatric and AYA oncology population. MATERIALS AND METHODS Study Design and Patient Selection We performed a retrospective chart review of oncology patients at Riley Hospital for Children and Indiana University Health who received at least 1 dose of the COVID-19 vaccine from March 2021 to August 2021 with an active or previous oncology diagnosis, treated on a pediatric oncology protocol. All patients cared for at these 2 sites who met the following were included: (1) 12 years of age or older to 35 years or younger of age, (2) received any COVID-19 vaccination (Moderna, Pzer, or J&J), and (3) had an active or previous oncology diagnosis. At the time of this manuscript, only the Pzer vaccine was available for children older than 12 years of age. Patients who received a COVID-19 vaccine outside the state of Indiana were exempt. Data was collected and reviewed from the initial COVID-19 vaccination date through 8- weeks following each vaccination, including prior COVID-19 testing. This 88 | www.jpho-online.com J Pediatr Hematol Oncol  Volume 45, Number 2, March 2023 Copyright r 2023 Wolters Kluwer Health, Inc. All rights reserved. J Pediatr Hematol Oncol  Volume 45, Number 2, March 2023 study was exempted from the institutional review board at Indiana University. Procedures and Statistical Design We obtained demographics, clinical symptoms, laboratory and imaging results, hospitalizations, and outcomes data from each patients electronic medical record. Clinical outcomes were followed up to 8 weeks after the last COVID vaccine was given. Our institutions COVID-19 vaccination guidelines followed recommendations outlined by the Centers for Disease Control, which recommended vaccination for all immunocompromised patients.5 Vaccination records for this study were obtained through the Children and Hoosier Immunization Registry Program (CHIRP), Indianas online vaccination database, and conrmed with the electronic medical record. Patients without a conrmed immunization history were excluded. The means, medians, SDs, and condence intervals of quantitative demographic variables, such as patient ages, were analyzed using GraphPad Prism (v9.2.0). Categorical data such as race, gender, diagnosis, therapies, vaccine status, and side effects were counted, and the proportions of those were calculated and presented in percentage. Observations We identied 122 unique patients who received a COVID-19 vaccination over the study period (Table 1). More than half of the patients were male (n = 86, 55.7%) with a median age of 18 years (range: 12-30 y). All 3 vaccine options were administered (Pzer n = 102, Moderna n = 17, J&J n = 3), and 98.4% (n = 120) of patients completed the primary vaccination series. Among these patients, 34.4% (n = 42) were actively receiving chemotherapy or within 9 months of receiving intensive chemotherapy. Of patients receiving leukemia therapy, the majority were in maintenance therapy (n = 7, 87.5%). Of the 122 patients who received the vaccine, 3 unique patients (2.5%) had a reported reaction. Of patients who had a reaction, all patients were white, male, had no prior COVID infection, and received the Pzer vaccine. Side effects were reported <24 hours of receiving the vaccine and resolved without intervention in <48 hours. No patients were hospitalized for fever and neutropenia or additional COVID-19 vaccine-related symptoms. We identied 47 (38.5%) patients who underwent imaging as part of their routine treatment or surveillance, including CT (n = 16), magnetic resonance imaging (n = 14), ultrasound (2), and radiograph (15), with only 1 patient found to have incidental lymphadenopathy (Fig. 1). Of the 2 patients with lymphadenopathy, Patient 1, who self-reported ipsilateral axillary lymphadenopathy, was 9 months postcompletion of anaplastic large cell lymphoma chemotherapy and presented 6 weeks after receiving the second Pzer vaccine. CT with contrast was concerning for a 5.03.0 cm axillary lymph node ipsilateral to vaccine administration. The suspicious lymph node was biopsied, and pathology was consistent with relapsed anaplastic large cell lymphoma. Patient 2, with lymphadenopathy found incidentally on routine CT with contrast imaging as part of treatment surveillance, was 3 months postchemotherapy for Hodgkin lymphoma. Imaging characteristics included a new right axillary lymph node measuring 1 cm with enlarged sub-centimeter bilateral axillary lymph nodes and a small 1 mm right upper lobe lung nodule (Fig. 1A). Follow-up 18FDG PET/CT scan 4 weeks later showed improvement of lymphadenopathy COVID-19 Vaccination in Children With Cancer TABLE 1. Patient Characteristics and Side Effects Following COVID-19 Vaccine Administration Cancer Cohort Characteristic N (%) Unique patients Male Sex Median age in years (range) Race/Ethnicity White Asian Black Pacic islander Hispanic/Latino Non-Hispanic/Latino Type of Cancer Solid tumor Leukemia Central nervous system Lymphoma Reported side effects within 8 wk Numbness Fever Chills Myalgia Headache Lymphadenopathy Routine surveillance imaging Incidental lymphadenopathy 122 68 (55.7) 18 (12-30) 112 5 4 1 10 112 (91.8) (4.1) (3.3) (0.8) (8.2) (91.8) 33 25 25 22 (27.0) (20.1) (20.1) (18.0) 2 1 1 1 1 1 47 1 (1.6) (0.82) (0.82) (0.82) (0.82) (0.82) (38.5) (0.82) with Deauville 2 score, consistent with prior scarred lymph nodes at the end of therapy (Fig. 1B), and complete resolution of his previously identied lung nodule. CONCLUSIONS The results of this cohort study suggest the majority of pediatric and AYA oncology patients 12 years of age or older had few side effects following COVID-19 vaccination. Those who did, reected what has been reported in the general adult population, with a lower incidence of reported and imaging-conrmed lymphadenopathy. Children with cancer are prone to severe COVID-19 infections,6 and oncologists hesitant to recommend the COVID-19 vaccination to patients both on and off therapy should be aware of the expected post-vaccine course to appropriately guide patients and families.7,8 Our retrospective review identied rare, mild, and self-limiting side effects without evidence of increased fever and neutropenia complications following the COVID-19 vaccine. As febrile neutropenia remains a serious complication for patients on therapy that leads to hospitalization, intravenous antibiotic administration, and burden for patients and hospitals, it is a reassuring nding in this cohort. In addition, we did not detect a higher incidence of symptomatic lymphadenopathy, which may provide reassurance to families struggling with vaccine hesitancy. Vaccine clinical trials are currently underway for children younger than 5 years old, with little published data surrounding side effects in the eligible pediatric oncology population. A limitation of this study is its retrospective nature, with a small sample size. In addition, this paper focuses on short-term clinical responses, while future research must address the immunologic response level in pediatric oncology patients. Future studies must focus on larger, prospective studies investigating side effects and incidental lymphadenopathy to better guide Copyright 2023 Wolters Kluwer Health, Inc. All rights reserved. www.jpho-online.com Copyright r 2023 Wolters Kluwer Health, Inc. All rights reserved. | 89 J Pediatr Hematol Oncol Belsky et al  Volume 45, Number 2, March 2023 FIGURE 1. Lymphadenopathy imaging findings post-COVID-19 vaccination. 1A, Initial CT Chest with Intravenous Contrast 36 hours post-COVID-19 vaccination. New right axillary lymph node measuring 1 cm. Additionally enlarged sub-centimeter right and left axillary lymph nodes. New tiny 1 mm right upper lobe lung nodule. 1B, Follow-up 18FDG PET/CT scan 4 weeks post-COVID-19 vaccination. Mildly FDG avid bilateral axially lymph nodes, likely reactive. No FDG pulmonary nodule was identified. Overall Deauville score 2. clinicians in counseling regarding COVID-19 vaccination in children and AYAs with cancer. 5. REFERENCES 1. Krammer F. SARS-CoV-2 vaccines in development. Nature. 2020;586:516527. 2. Mehta N, Sales RM, Babagbemi K, et al. Unilateral axillary Adenopathy in the setting of COVID-19 vaccine. Clin Imaging. 2021;75:1215. 3. Tu W, Gierada DS, Joe BN. COVID-19 vaccination-related lymphadenopathy: What to be aware of. Radiol Imaging Cancer. 2021;3:e210038. 4. Local Reactions, Systemic Reactions, Adverse Events, and Serious Adverse Events: Pfizer-BioNTech COVID-19 Vaccine. 6. 7. 8. Accessed December 12, 2021. 2021. https://www.cdc.gov/ vaccines/covid-19/info-by-product/pfizer/reactogenicity.html COVID-19 Vaccines are Effective. 2021. Accessed December 25, 2021, https://www.cdc.gov/coronavirus/2019-ncov/vaccines/ effectiveness/index.html Belsky JA, Tullius BP, Lamb MG, et al. COVID-19 in immunocompromised patients: a systematic review of cancer, hematopoietic cell and solid organ transplant patients. J Infect. 2021;82:329338. Biswas N, Mustapha T, Khubchandani J, et al. The Nature and extent of COVID-19 vaccination hesitancy in healthcare workers. J Community Health. 2021;46:12441251. Wolfson S, Kim E, Plaunova A, et al. Axillary adenopathy after COVID-19 vaccine: no reason to delay screening mammogram. Reig Radiology. 2022;303:297299. 90 | www.jpho-online.com Copyright 2023 Wolters Kluwer Health, Inc. All rights reserved. Copyright r 2023 Wolters Kluwer Health, Inc. All rights reserved.  ...

... The item referenced in this repository content can be found by following the link on the descriptive page.  ...

... International Journal of Molecular Sciences Brief Report Soft Tissue Manipulation Alters RANTES/CCL5 and IL-4 Cytokine Levels in a Rat Model of Chronic Low Back Pain Carmela L. Marciano 1,2, , Taylor A. Hiland 1,2, , Krista L. Jackson 1,2 , Sierra Street 1,2 , Carson Maris 2 , Andrew Ehrsam 1,2 , Julia M. Hum 1,2,3 , Mary Terry Loghmani 4,5 , Tien-Min G. Chu 5,6 , Kyung S. Kang 2,3,7 and Jonathan W. Lowery 1,2,3,5,8,9, * 1 2 3 4 5 6 7 8 9 * Citation: Marciano, C.L.; Hiland, T.A.; Jackson, K.L.; Street, S.; Maris, C.; Ehrsam, A.; Hum, J.M.; Loghmani, M.T.; Chu, T.-M.G.; Kang, K.S.; et al. Soft Tissue Manipulation Alters RANTES/CCL5 and IL-4 Cytokine Levels in a Rat Model of Chronic Low Back Pain. Int. J. Mol. Sci. 2023, 24, 14392. https://doi.org/10.3390/ ijms241814392 Academic Editor: Suk-Yun Kang Received: 18 August 2023 Revised: 12 September 2023 Accepted: 17 September 2023 Published: 21 September 2023 Copyright: 2023 by the authors. Division of Biomedical Science, College of Osteopathic Medicine, Marian University, Indianapolis, IN 46222, USA; cmarciano@marian.edu (C.L.M.); thiland@marian.edu (T.A.H.); sst694@marian.edu (S.S.); aehrsam088@marian.edu (A.E.); jmhum@marian.edu (J.M.H.) Bone & Muscle Research Group, Marian University, Indianapolis, IN 46222, USA; cmaris@butler.edu (C.M.); kkang@marian.edu (K.S.K.) Indiana Biosciences Research Institute, Indianapolis, IN 46222, USA Department of Physical Therapy, School of Health and Human Sciences, Indiana University, Indianapolis, IN 46222, USA; mloghman@iu.edu Indiana Center for Musculoskeletal Health, School of Medicine, Indiana University, Indianapolis, IN 46222, USA; tgchu@iu.edu Department of Biomedical Sciences and Comprehensive Care, School of Dentistry, Indiana University, Indianapolis, IN 46222, USA Witchger School of Engineering, Marian University, Indianapolis, IN 46222, USA Division of Academic Affairs, Marian University, Indianapolis, IN 46222, USA Department of Orthopaedic Surgery, School of Medicine, Indiana University, Indianapolis, IN 46222, USA Correspondence: jlowery@marian.edu; Tel./Fax: +1-317-955-6621 These authors contributed equally to this work. Abstract: Low back pain (LBP) is a common musculoskeletal complaint that can impede physical function and mobility. Current management often involves pain medication, but there is a need for non-pharmacological and non-invasive interventions. Soft tissue manipulation (STM), such as massage, has been shown to be effective in human subjects, but the molecular mechanisms underlying these findings are not well understood. In this paper, we evaluated potential changes in the soft tissue levels of more than thirty pro- or anti-inflammatory cytokines following instrument-assisted STM (IASTM) in rats with chronic, induced LBP using Complete Freunds Adjuvant. Our results indicate that IASTM is associated with reduced soft tissue levels of Regulated on Activation, Normal T cell Expressed and Secreted (RANTES)/Chemokine (C-C motif) ligand 5 (CCL5) and increased soft tissue levels of Interleukin (IL)-4, which are pro-inflammatory and anti-inflammatory factors, respectively, by 120 min post-treatment. IASTM was not associated with tissue-level changes in C-X-C Motif Chemokine Ligand (CXCL)-5/Lipopolysaccharide-Induced CXC Chemokine (LIX) which is the murine homologue of IL-8, CXCL-7, Granulocyte-Macrophage-Colony Simulating Factor (GM-CSF), Intercellular Adhesion Molecule (ICAM)-1, IL1-Receptor Antagonist (IL-1ra), IL-6, Interferon-Inducible Protein (IP)-10/CXCL-10, L-selectin, Tumor Necrosis Factor (TNF)-, or Vascular Endothelial Growth Factor (VEGF) at either 30 or 120 min post-treatment. Combined, our findings raise the possibility that IASTM may exert tissue-level effects associated with improved clinical outcomes and potentially beneficial changes in pro-/anti-inflammatory cytokines in circulation and at the tissue level. Keywords: inflammation; massage; soft tissue manipulation; cytokine; low back pain; musculoskeletal Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). 1. Introduction Low back pain (LBP) is a common complaint among adults, with approximately 39 percent of Americans experiencing LBP in 2019 [1]. Pharmacological intervention, Int. J. Mol. Sci. 2023, 24, 14392. https://doi.org/10.3390/ijms241814392 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2023, 24, 14392 2 of 9 such as acetaminophen and non-steroidal inflammatory drugs (NSAIDS), is the first-line treatment for LBP [2]. Pharmaceuticals as the primary treatment for LBP can be costly and less accessible, especially for the 44.8 percent of individuals that struggle with back pain and live below the federal poverty level [1]. Additionally, opioids are commonly prescribed for low back pain, and more than half of opioid users have reported LBP despite these medications showing limited efficacy for this condition [3]. Prior work in human subjects indicates that soft tissue manipulation (STM), such as massage, may accelerate the return to function, improve mental and emotional wellbeing, and reduce the need for opioid medication usage [4]. However, the heterogeneity of lifestyles and body conditions, potential co-morbidities, and the inherent mindbody aspect of manual therapies complicate our understanding of the molecular mechanisms underlying these findings. Instrument-assisted STM (IASTM) is a manual therapy modality that stimulates painful areas of soft tissue with a rigid instrument. A recent study indicated that IASTM improves gait patterns in rats with induced LBP [5], suggesting that IASTM may promote pain relief and/or functional recovery from LBP. This same study revealed that IASTM modulated the serum levels of cytokines involved in pain and the inflammatory response, resulting in increased levels of Neuropeptide-Y (NPY) and reduced levels of Regulated on Activation, Normal T cell Expressed and Secreted (RANTES)/Chemokine (C-C motif) ligand 5 (CCL5) within three and fourteen days of treatment, respectively [5]. Despite these findings, the molecular changes associated with STM in the tissue itself remain uncertain. This knowledge gap may prevent future therapeutic potential and widespread adoption of this non-invasive approach to pain management and inflammation. Thus, we sought to extend prior work on IASTM in a rat model of induced LBP to examine the potential changes in tissue levels of more than thirty pro- or anti-inflammatory cytokines following IASTM. Our results indicate that IASTM is associated with reduced soft tissue levels of RANTES/CCL5 and increased soft tissue levels of IL-4, which are pro-inflammatory and anti-inflammatory cytokines, respectively. These findings advance the mechanistic understanding of tissue-level responses to IASTM and provide rationale for future studies involving STM in human subjects with LBP. 2. Results A general schematic of the animal model is presented in Figure 1. To examine the tissue-specific changes associated with IASTM, homogenates from muscle biopsies were pooled within treatment groups and subjected to membrane-based cytokine arrays, which examined the expression levels of nearly thirty targets simultaneously (Figure 2A). These assays detected seven targets in at least one condition, whereas the other targets were below the detection limit (Figure 2A). Of these seven, only RANTES/CCL5 (Figure 2B) and Tissue Inhibitor of Metalloproteinase (TIMP)-1 (Figure 2C) were altered by 50% in IASTM-treated samples compared to untreated injury controls, with a reduction in the levels of both cytokines in samples obtained 120 min following IASTM; the other targets C-X-C Motif Chemokine Ligand (CXCL)-7 (Figure 2D), Vascular Endothelial Growth Factor (VEGF) (Figure 2E), L-selectin (Figure 2F), Interleukin (IL)-1 Receptor Antagonist (IL1-ra) (Figure 2G), and Intercellular Adhesion Molecule (ICAM)-1(Figure 2H)did not meet this threshold for further analysis. Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW Int. J. Mol. Sci. 2023, 24, 14392 3 of 9 3 of 9 Figure 1. Schematic of study design and timeline. (A): For samples in the present study, injury Figure 1. Schematic of study design and timeline. (A): For samples in the present study, injury was was performed on Day 0 to n = 15 rats using an injection of Complete Freunds Adjuvant (CFA). performed on Day 0 to n = 15 rats using an injection of Complete Freunds Adjuvant (CFA). Rats Rats were then randomly assigned to sham (i.e., untreated) (n = 5) or instrument-assisted soft tissue were then randomly assigned to sham (i.e., untreated) (n = 5) or instrument-assisted soft tissue mamanipulation (IASTM) treatment = 10) intervention3 3times timesper perweek weekover over two two weeks weeks for for five nipulation (IASTM) treatment (n (n = 10) forforintervention ve minutes per session. On Day 14, IASTM treatment group was further divided into sacrifice minutes per session. On Day 14, IASTM treatment group was further divided into sacrice within within 30 min min (n (n == 5) 5) or or 22 hh (n (n== 5) 5) post post final nal IASTM IASTM session. session. (B): (B): Cage Cage controls controls (n (n == 3) 3) were were maintained maintained without intervention. intervention. without Given that the results for the membrane arrays were generated using pooled samples, Given that the results for membrane arrays were generated using pooled samples, we next sought to validate thethe findings for RANTES/CCL5 and TIMP-1 using ELISA on we next sought to validate the ndings RANTES/CCL5 and confirmed TIMP-1 using on individual samples to perform statisticalfor testing. These results thatELISA the level individual samples to perform statistical testing. These results conrmed that the level of of RANTES was higher in untreated injury samples, compared to cage controls, and was RANTES was higher in untreated injury samples, compared to cage controls, and was reduced within 120 min following IASTM (Figure 3A). In contrast, TIMP-1 levels were more reducedbetween within 120 min following IASTM (Figure 3A). In contrast, TIMP-1 variable samples and did not reach statistical significance in this assay levels (Figurewere 3B). moreELISAs variable between samples and did not reach statistical signicance in this assay (Figwere also utilized to interrogate the levels of several other cytokines/chemokines ureinterest 3B). that were not detected on the membrane array, including IL-4, Granulocyteof ELISAs Colony were also utilized toFactor interrogate the levels several other cytokines/chemoMacrophage Stimulating (GM-CSF), IL-6,of Intergeron-Inducible Protein (IP)kines of interest that were not detected on the membrane including IL-4, Granulo10/CXCL-10, CXCL-5/Lipopolysaccharide-Induced CXCarray, Chemokine (LIX), and Tumor cyte-Macrophage Colony Stimulating Factor (GM-CSF), IL-6, Intergeron-Inducible ProNecrosis Factor (TNF)- (Figure 3CH). Among these, only IL-4 levels were altered in tein (IP)-10/CXCL-10, CXCL-5/Lipopolysaccharide-Induced CXC Chemokine (LIX), and samples subjected to IASTM compared to untreated injury controls, with levels of this Tumor Necrosis Factor (TNF)- (Figure 3CH). Amongobtained these, only were IASTM altered cytokine increasing by approximately 3-fold in samples 120IL-4 minlevels following in samples (Figure 3C).subjected to IASTM compared to untreated injury controls, with levels of this cytokine increasing by approximately 3-fold in samples obtained 120 min following IASTM (Figure 3C). Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW Int. J. Mol. Sci. 2023, 24, 14392 4 of 9 4 of 9 Figure arraysfor forlevels levelsofof select targets in muscle tissue homogenates. HoFigure2.2.Membrane-based Membrane-based arrays select targets in muscle tissue homogenates. Homogmogenates were generated muscle biopsies collected fromcontrols cage controls rats subjected to enates were generated fromfrom muscle biopsies collected from cage or ratsor subjected to injury without treatment (untreated), injury plusplus IASTM with biopsy collected within injury without treatment (untreated), injury IASTM with biopsy collected within3030min minofof nal final IASTM,ororinjury injuryplus plusIASTM IASTMwith withbiopsy biopsycollected collected 22 hh post-IASTM. post-IASTM. Samples were pooled IASTM, pooled within within treatment conditions with representative images of array results in (A). The data are expressed as treatment conditions with representative images of array results in (A). The data are expressed as fold fold change relative to untreated injury control for RANTES (B), TIMP-1 (C), CXCL-7 (D), ICAM-1 change relative to untreated injury control for RANTES (B), TIMP-1 (C), CXCL-7 (D), VEGF (E), L(E), IL-1ra (F), L-selectin (G), and VEGF (H). For TIMP-1, the value for the cage control group is selectin (F), IL-1ra (G), and ICAM-1 (H). For TIMP-1, the value for the cage control group is presented presented in text. For IL-1ra, the signal was not detected (ND) for the cage control group. in text. For IL-1ra, the signal was not detected (ND) for the cage control group. Int. FOR PEER REVIEW Int.J.J.Mol. Mol.Sci. Sci.2023, 2023,24, 24,x14392 5 5ofof99 Figure forfor levels of select targets in muscle tissue homogenates. Homogenates were genFigure3.3.ELISAs ELISAs levels of select targets in muscle tissue homogenates. Homogenates were erated from muscle biopsies collected from cage controls or rats subjected to injury without treatgenerated from muscle biopsies collected from cage controls or rats subjected to injury without ment (untreated), injuryinjury plus IASTM with biopsy collected within within 30 min30 of min nalof IASTM, or injury treatment (untreated), plus IASTM with biopsy collected final IASTM, or plus IASTM with biopsy collected 2 h post-IASTM. Multiplex ELISAs were performed to quantify injury plus IASTM with biopsy collected 2 h post-IASTM. Multiplex ELISAs were performed to the levels of RANTES (A), TIMP-1 (B), IL-4 (C), GM-CSF (D), IL-6 (E), IP-10/CXCL10 (F), LIX (G), quantify the levels of RANTES (A), TIMP-1 (B), IL-4 (C), GM-CSF (D), IL-6 (E), IP-10/CXCL10 (F), and TNF- (H). n = 3 for cage controls and n = 5 for other treatment groups. The data are pg/mL LIX (G),IL-6 andwhich TNF- n= 3 for cage controls n = 5and for expressed other treatment groups. The data are (except is (H). mean uorescence intensityand (MIF)) as mean SEM. Statistical pg/mLwas (except IL-6 which mean fluorescence intensity and expressed as testing mean SEM. testing performed using is a one-way ANOVA with Dunne(MIF)) s multiple comparison where performed using a one-way ANOVA Dunnetts multiple comparison *Statistical indicates ptesting < 0.05 was against cage control and indicates p < 0.05with against untreated injury control. testing where * indicates p < 0.05 against cage control and indicates p < 0.05 against untreated control. 3.injury Discussion LBP is one of the most common problems aecting people of all ages and can be 3. Discussion caused by a variety of factors, including injury, poor posture, and underlying medical LBP is one of the most common problems affecting people of all ages and can be conditions. This makes it dicult to determine the eective course of treatment, consecaused by a variety of factors, including injury, poor posture, and underlying medical conquently making LBP challenging to manage. The prevalence and challenge of managing ditions. This makes it difficult to determine the effective course of treatment, consequently LBP has encouraged research into non-pharmacological and non-invasive therapies in an making LBP challenging to manage. The prevalence and challenge of managing LBP has Int. J. Mol. Sci. 2023, 24, 14392 6 of 9 encouraged research into non-pharmacological and non-invasive therapies in an effort to find a less expensive, non-addictive, and yet effective form of treatment. The financial burden of healthcare costs associated with prescription medication and more invasive treatments, like surgery, may be reduced by alternatives like STM and massage. Although these alternatives are not one-size-fits-all treatments for LBP, these non-invasive treatments are known to have benefits for LBP such as reducing pain, improving range of motion, increasing circulation, etc. [4]. One of the potential mechanisms of these benefits is the regulation of inflammation, as suggested in our previous report [5]. Therefore, we further hypothesized that a better understanding of molecular changes of more inflammatory cytokines could open up wide adoption of STM and/or massage to manage LBP. Our study analyzed tissue homogenates from muscle biopsies in several groups: uninjured cage controls, injured without treatment, injured + IASTM (sampled and collected within 30 min of treatment), and injured + IASTM (sampled and collected within 120 min of treatment). Our results indicated that this model of chronic LBP leads to elevated soft tissue levels of the chemokine RANTES and that IASTM decreased the levels of RANTES in rats within 120 min of treatment. This is consistent with a prior report demonstrating that IASTM decreased serum levels of RANTES in this same model, suggesting that injured tissue may be a major source of serum RANTES in this model [5]. Given that RANTES exerts generally pro-inflammatory effects [6], these findings provide important molecular-level information on a potential role for IASTM in reducing inflammation in vivo. Additionally, we found that, at the same time point, IASTM increases tissue levels of IL-4, which has been shown to suppress the production of pro-inflammatory cytokines TNF-alpha and IL-1 while also stimulating the production of the IL-1 receptor antagonist (IL-1ra) [7]. IL-4 has also been linked to macrophage activation which counteracts inflammation by releasing IL-1ra, IL-10, and TGF- [7]. Thus, our observation of increased tissue levels of IL-4 following IASTM supports a potential anti-inflammatory effect of this treatment modality. Notably, neither the present study nor the prior report detected changes in IL-6 or IL-10 levels in either the tissue or serum following IASTM [5]. Additionally, although our prior report demonstrated increased serum levels of NPY following IASTM, those results were obtained from animals subjected to a short, 3-day total IASTM treatment protocol rather than the 14-day protocol used here [5]. We did not allocate the limited resources in the present study to examine NPY since its levels at the 14-day time point did not differ between groups. TIMP-1 is an inflammation-related protein that inhibits the activity of matrix metalloproteinases (MMPs), potentially preventing MMPs from breaking down the extracellular matrix [8]. TIMP-1 also has cytokine-line functions, such as binding to receptors on the surface of immune cells and regulating signaling pathways that influence cell behavior [8]. Many inflammatory diseases, including rheumatoid arthritis, asthma, and psoriasis, show upregulated levels of TIMP-1, suggesting that this protein could be a promising therapeutic target for the development of new anti-inflammatory treatments [9]. Our findings regarding TIMP-1 were variable between methodologies, but it is worth noting that this protein has mRNA splice variants which may alter the amino acid sequence [10,11]. Since the assays contained proprietary information, the manufacturers were unwilling to disclose details regarding the specific immunogen used to develop the antibodies; thus, we are unable to comment on the discrepancy between techniques. We additionally investigated tissue levels of several other proteins that have been associated with pro- or anti-inflammatory effects and may play a role in various types of LBP, including CXCL5/LIX (the murine homolog of IL-8), GM-CSF, ICAM-1, IL1-ra, IL-6, IP-10/CXCL10, TNF-, and VEGF [1214]. However, our analyses were unable to detect any IASTM-mediated effects on the levels of these cytokines in this model. These findings may be representative of the limitations of our current study (see below). It is important to note that our study has several important limitations which may impact its generalizability. First, our design includes evaluation of only male rats at a Int. J. Mol. Sci. 2023, 24, 14392 7 of 9 single time point (two weeks post-injury) in a single model of chronic, induced LBP using Freunds adjuvant. Thus, it is possible that these and/or other factors were altered earlier or later in the time course of induced LBP or with IASTM. Additionally, our analyses were performed on a relatively small sample size due to the availability of samples from a prior study. This potentially impacted our power to detect minor changes in specific factors between groups. And, although sham and IASTM-treated groups were handled and restrained identically, cage controls were not subjected to such intervention; therefore, it is formally possible that the observed increase in RANTES in untreated injured controls, compared to cage controls, was due to stress or some factor other than the LBP model. Finally, it is also possible that the effects observed in the tissue levels of RANTES and IL-4 were not the result of mechanical force per se, but were related to other aspects of the intervention, such as transient hyperemia or, since the rats were conscious, the mindbody aspects of massage. That said, taken with the observations of Loghmani et al. related to gait and circulating factors [5], our study is consistent with the notion that IASTM may exert anti-inflammatory effects in LBP and could be a promising treatment option for individuals suffering from musculoskeletal inflammation or injury. Future work is required to confirm this possibility. 4. Materials and Methods 4.1. Animal Model and Soft Tissue Biopsies All soft tissue biopsies utilized in this study were collected from rats involved in a prior report and full details of the animal husbandry, injury model, and IASTM interventions may be found therein [5]. Briefly, adult male Sprague-Dawley rats (11 to 16 weeks old) were kept as cage controls (n = 3) or subjected to induced chronic inflammatory LBP through injection of 50 L Complete Freunds adjuvant (CFA) unilaterally while the animals were under isoflurane anesthesia. Samples discussed in the present study were obtained at sacrifice from cage controls or injured rats 14 days post-injection randomized to the following groups: (1) sham treatment (n = 5) or (2) three IASTM sessions/week to the region of injury over two weeks (6 IASTM sessions in total) (n = 10) was performed while conscious. All IASTM sessions were administered by a single examiner, who was trained and experienced in IASTM, using an IASTM device designed for treating small areas to manipulate the injured tissue [4]. Animals in both sham and treatment groups were handled the same removal from the cage, covering of the head with a towel, and placed in a swaddling handhold as described previously. Sham treatment was carried out using a light stroke from a soft-bristled paint brush. The IASTM treatment (or sham) lasted 5 min/session at a pressure within the subjects tolerancefor example, no withdrawal response, no fur pigmentation/discoloration, or vocalizationusing an average force of 2.46 N 0.42 N (i.e., 0.55 0.09 lbs) [5]. Rats were euthanized by asphyxiation using carbon dioxide, and immediately post-mortem, muscle biopsies were collected from the region of injury and subsequently snap frozen. Rats in Group 2 were sacrificed within 30 min post-IASTM (n = 5) or two hours post-IASTM (n = 5) to compare the immediate and delayed effects of soft tissue manipulation. All animal procedures were performed in alignment with a protocol approved by the Indiana University Institutional Animal Care & Use Committee and national standards. Muscle biopsies were homogenized in 1X RIPA buffer (Cell Signaling, Danvers, MA, USA) with 1X Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, Waltham, MA, USA) using a Bullet Blender (Next Advance, Troy, NY, USA). Protein concentration was determined using a BCA Assay (Thermo Fisher Scientific, Waltham, MA, USA) on a FilterMax F3 plate reader (Molecular Devices, San Jose, CA, USA). 4.2. Cytokine Membrane Array Pooled tissue homogenates were analyzed using the Proteome Profiler Rat Cytokine Array Kit Panel A (R&D Systems, Minneapolis, MN, USA) as directed by the manufacturer and as reported previously [15]. This multiplex assay provided simultaneous Int. J. Mol. Sci. 2023, 24, 14392 8 of 9 measurement of the following targets: CCL3/MIP-1 alpha, CCL5/RANTES, CCL20/MIP3 alpha, CNTF, CXC3CL1/Fractalkine, CXCL1/CINC-1, CXCL3/CINC-2 alpha/beta, CXCL2/CINC-3, CXCL7/Thymus Chemokine, CXCL9/MIG, CXCL10/IP-10, GM-CSF, ICAM-1, IFN-gamma, IL-1 alpha/IL-1F1, IL-1ra/IL-1F3, IL-2, IL-3, IL-4, IL-6, IL-10, IL-13, IL-17, L-Selectin, TIMP-1, TNF-alpha, and VEGF. Briefly, 80 g total protein was pooled for each individual rat within the respective treatment group (n = 5 per treatment group except cage control where n = 3) resulting in a 400 g total protein sample being loaded onto each membrane. The arrays were developed using WesternBright Quantum reagent (Advansta, San Jose, CA, USA) on a C-Digit scanner (LI-COR, Lincoln, NE, USA) and signal densities were determined using the Empiria Studio Version 2.3 software package (LI-COR). Data for each target were expressed relative to the average reference spot density on the respective membrane and normalized to the untreated sample. 4.3. Enzyme-Linked Immunosorbent Assays Individual tissue homogenates were analyzed using a custom-made GeniePlex Multiplex Assay (AssayGenie, Dublin, Ireland) to quantify levels of CXCL10, GM-CSF, IL-4, IL-6, LIX, TNF-, TIMP-1, and RANTES. The assay was performed as directed by the manufacturer, except 1X RIPA plus Halt Protease Inhibitor Cocktail was substituted for the tissue lysis buffer included with the kit. Assays were run on an Accuri C6 Flow Cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) using 300 g total protein per sample. Quantification of results was performed by AssayGenie using FCAP Array Software Version 3.0 (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) by a scorer that was blinded to sample identity. 4.4. Statistical Analyses Statistical analyses were performed using GraphPad Prism 9 (GraphPad Software, Boston, MA, USA) as described in each respective figure legend. A p-value of <0.05 was considered significant. 5. Conclusions Our study found that IASTM is associated with reduced soft tissue levels of RANTES/ CCL5 and increased soft tissue levels of IL-4 in rats with chronic, induced LBP. Combined with our prior report demonstrating that IASTM improved gait patterns in rats with induced LBP [5], the present findings suggest that IASTM exerts effects involving changes in pro-/anti-inflammatory cytokines in circulation and at the tissue level. Future studies are needed to confirm these findings in human subjects and to investigate the long-term effects of IASTM on soft tissue levels of pro- and anti-inflammatory cytokines. Author Contributions: Conceptualization, M.T.L. and J.W.L.; Methodology, C.L.M., T.A.H., M.T.L. and J.W.L.; Validation, C.L.M., T.A.H., M.T.L. and J.W.L.; Formal Analysis, C.L.M., T.A.H., M.T.L. and J.W.L.; Investigation, C.L.M., T.A.H., K.L.J., S.S., C.M., A.E., J.M.H., M.T.L., T.-M.G.C., K.S.K. and J.W.L.; Resources, M.T.L. and J.W.L.; Data Curation, M.T.L. and J.W.L.; WritingOriginal Draft Preparation, C.L.M., T.A.H., M.T.L. and J.W.L.; WritingReview and Editing, C.L.M., T.A.H., K.L.J., S.S., C.M., A.E., J.M.H., M.T.L., T.-M.G.C., K.S.K. and J.W.L.; Visualization, C.L.M., T.A.H. and J.W.L.; Supervision, M.T.L. and J.W.L.; Project Administration, M.T.L. and J.W.L.; Funding Acquisition, M.T.L. and J.W.L. All authors have read and agreed to the published version of the manuscript. Funding: Funding was provided by a Marian University College of Osteopathic Medicine Faculty Research Development award (issued to JWL) and other intramural funds. Institutional Review Board Statement: This study did not involve human subjects and IRB approval is not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Datasets used and/or analyzed are available from the corresponding author on reasonable request. Int. J. Mol. Sci. 2023, 24, 14392 9 of 9 Acknowledgments: We gratefully acknowledge members of the Marian University Bone & Muscle Research Group and the Indiana Center for Musculoskeletal Health for critical feedback on this project. Conflicts of Interest: The authors declare no conflict of interest. References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Lucas, J.W.; Connor, E.M.; Bose, J. Back, Lower Limb, and Upper Limb Pain Among U.S. Adults, 2019. NCHS Data Brief 2021, 415, 18. Last, A.R.; Hulbert, K. Chronic low back pain: Evaluation and management. Am. Fam. Physician 2009, 79, 10671074. [CrossRef] [PubMed] Deyo, R.A.; Von Korff, M.; Duhrkoop, D. Opioids for low back pain. BMJ 2015, 350, g6380. [CrossRef] Kumar, S.; Beaton, K.; Hughes, T. The effectiveness of massage therapy for the treatment of nonspecific low back pain: A systematic review of systematic reviews. Int. J. Gen. Med. 2013, 6, 733741. [CrossRef] Loghmani, M.T.; Tobin, C.; Quigley, C.; Fennimore, A. Soft Tissue Manipulation May Attenuate Inflammation, Modulate Pain, and Improve Gait in Conscious Rodents with Induced Low Back Pain. Mil. Med. 2021, 186 (Suppl. S1), 506514. [CrossRef] Marques, R.E.; Guabiraba, R.; Russo, R.C.; Teixeira, M.M. Targeting CCL5 in inflammation. Expert Opin. Ther. Targets 2013, 17, 14391460. [CrossRef] [PubMed] Woodward, E.A.; Prele, C.M.; Nicholson, S.E.; Kolesnik, T.B.; Hart, P.H. The anti-inflammatory effects of interleukin-4 are not mediated by suppressor of cytokine signalling-1 (SOCS1). Immunology 2010, 131, 118127. [CrossRef] [PubMed] Ries, C. Cytokine functions of TIMP-1. Cell. Mol. Life Sci. CMLS 2014, 71, 659672. [CrossRef] [PubMed] Knight, B.E.; Kozlowski, N.; Havelin, J.; King, T.; Crocker, S.J.; Young, E.E.; Baumbauer, K.M. TIMP-1 Attenuates the Development of Inflammatory Pain through MMP-Dependent and Receptor-Mediated Cell Signaling Mechanisms. Front. Mol. Neurosci. 2019, 12, 220. [CrossRef] [PubMed] Usher, P.A.; Sieuwerts, A.M.; Bartels, A.; Lademann, U.; Nielsen, H.J.; Holten-Andersen, L.; Foekens, J.A.; Brunner, N.; Offenberg, H. Identification of alternatively spliced TIMP-1 mRNA in cancer cell lines and colon cancer tissue. Mol. Oncol. 2007, 1, 205215. [CrossRef] [PubMed] Obro, N.F.; Lademann, U.; Birkenkamp-Demtroder, K.; Holten-Andersen, L.; Brunner, N.; Offenberg, H. A TIMP-1 splice variant transcript: Possible role in regulation of TIMP-1 expression. Cancer Lett. 2008, 262, 6470. [CrossRef] [PubMed] Shnayder, N.A.; Ashhotov, A.V.; Trefilova, V.V.; Nurgaliev, Z.A.; Novitsky, M.A.; Vaiman, E.E.; Petrova, M.M.; Nasyrova, R.F. Cytokine Imbalance as a Biomarker of Intervertebral Disk Degeneration. Int. J. Mol. Sci. 2023, 24, 2360. [CrossRef] [PubMed] Risbud, M.V.; Shapiro, I.M. Role of cytokines in intervertebral disc degeneration: Pain and disc content. Nat. Rev. Rheumatol. 2014, 10, 4456. [CrossRef] [PubMed] Yang, J.E.; Zhao, K.H.; Qu, Y.; Zou, Y.C. Increased serum CXCL10 levels are associated with clinical severity and radiographic progression in patients with lumbar disc degeneration. Clin. Chim. Acta 2022, 525, 1522. [CrossRef] [PubMed] Anloague, A.; Mahoney, A.; Ogunbekun, O.; Hiland, T.A.; Thompson, W.R.; Larsen, B.; Loghmani, M.T.; Hum, J.M.; Lowery, J.W. Mechanical stimulation of human dermal fibroblasts regulates pro-inflammatory cytokines: Potential insight into soft tissue manual therapies. BMC Res. Notes 2020, 13, 400. [CrossRef] [PubMed] Disclaimer/Publishers Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  ...

... www.aging-us.com AGING 2023, Vol. 15, No. 3 Research Paper The lipidomes of C. elegans with mutations in asm-3/acid sphingomyelinase and hyl-2/ceramide synthase show distinct lipid profiles during aging Trisha A. Staab1, Grace McIntyre1, Lu Wang2, Joycelyn Radeny4, Lisa Bettcher3, Melissa Guillen1, Margaret P. Peck4, Azia P. Kalil4, Samantha P. Bromley4, Daniel Raftery3, Jason P. Chan1 1 Department of Biology, Marian University, Indianapolis, IN 46222, USA Department of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA 98195, USA 3 Northwest Metabolomics Research Center, University of Washington, Seattle, WA 98195, USA 4 Department of Biology, Juniata College, Huntingdon, PA 16652, USA 2 Correspondence to: Jason P. Chan; email: jpchan@me.com, https://orcid.org/0000-0001-8123-536X Keywords: lipidomics, aging, sphingolipid metabolism, C. elegans, fatty acid metabolism Received: June 24, 2022 Accepted: February 1, 2023 Published: February 13, 2023 Copyright: 2023 Staab et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Lipid metabolism affects cell and physiological functions that mediate animal healthspan and lifespan. Lipidomics approaches in model organisms have allowed us to better understand changes in lipid composition related to age and lifespan. Here, using the model C. elegans, we examine the lipidomes of mutants lacking enzymes critical for sphingolipid metabolism; specifically, we examine acid sphingomyelinase (asm-3), which breaks down sphingomyelin to ceramide, and ceramide synthase (hyl-2), which synthesizes ceramide from sphingosine. Worm asm-3 and hyl-2 mutants have been previously found to be long- and short-lived, respectively. We analyzed longitudinal lipid changes in wild type animals compared to mutants at 1-, 5-, and 10-days of age. We detected over 700 different lipids in several lipid classes. Results indicate that wildtype animals exhibit increased triacylglycerols (TAG) at 10-days compared to 1-day, and decreased lysophoshatidylcholines (LPC). We find that 10-day hyl-2 mutants have elevated total polyunsaturated fatty acids (PUFA) and increased LPCs compared to 10-day wildtype animals. These changes mirror another shortlived model, the daf-16/FOXO transcription factor that is downstream of the insulin-like signaling pathway. In addition, we find that hyl-2 mutants have poor oxidative stress response, supporting a model where mutants with elevated PUFAs may accumulate more oxidative damage. On the other hand, 10-day asm-3 mutants have fewer TAGs. Intriguingly, asm-3 mutants have a similar lipid composition as the long-lived, caloric restriction model eat-2/mAChR mutant. Together, these analyses highlight the utility of lipidomic analyses to characterize metabolic changes during aging in C. elegans. fatty acids (FA), triacylglycerols (TAG), sphingolipids (SL), and phospholipids (PL) have been identified as targets in lipid signatures related to aging [2, 3]. Furthermore, specific signatures are detected in the lipid profiles of those with age-related diseases, such as Alzheimers Disease [49]. In addition, the abundance INTRODUCTION Lipidomic analysis is an emerging field for investigating lifespan regulation and age-related diseases. Lipidomic profiles can be determinants of lifespan and disease conditions [1, 2]. For example, lipid classes including www.aging-us.com 650 AGING of many fatty acid subtypes differs between the youth, elderly, and centenarians [10, 11]. example, knockdown of elo-2, a fatty acid elongase, results in increased lifespan, while knockdown of elo-5 decreases lifespan. In addition, genetic studies targeting sphingolipid metabolism suggest that specific enzymes may mediate lifespan in worms and flies, and chronological and replicative lifespan in yeast [25, 3234]. Lipids serve diverse functions and occur in varied locations within cells. The lipid composition of cell membranes can affect aging processes through regulating protein localization, peroxidation, and cell structure. Intracellular lipids, on the other hand, can be involved in signaling, be sources of energy storage, and affect trafficking and organelle functions related to stress responses [12, 13]. For example, the degree of saturation of membrane fatty acids and the levels of polyunsaturated fatty acids (PUFAs) may mediate oxidative damage associated with aging cells [2]. Lipid analyses using model organisms have correlated longevity to elevated PUFAs, as these long carbon chains are more susceptible to oxidative damage [2, 14]. Furthermore, breakdown of lipid droplets that store TAG through lipophagy may release specific fatty acids that mediate the transcriptional regulation of genes involved in stress response and longevity [13, 15, 16]. While TAG levels determine cellular energy storage, total TAGs may have both beneficial and detrimental roles depending on the type of lipid and the organism [17, 18]. Studies identifying new regulators of aging are critical, given the global rise in an aging population. Lipidomic studies serve as a powerful approach to identify specific metabolic pathways that may contribute to organismal longevity, healthy aging, or pathology. Indeed, lipidomic approaches in long-lived humans and model organisms have provided insight into the lipid changes associated with healthy aging [1, 17, 35]. In particular, work using C. elegans have identified age related changes in specific lipids, lipid classes, as well as the ratio of monosaturated to polysaturated fatty acids (MUFA:PUFA ratio) [36, 37]. Here, we examine the lipidomes of animals lacking the sphingolipid metabolism enzymes, asm-3/acid sphingomyelinase or hyl-2/ceramide synthase, which have previously been shown to have extended and reduced lifespans, respectively, in C. elegans [24, 34, 38]. Understanding enzymatic regulation of sphingolipid metabolism is valuable, as changes to sphingomyelins and ceramides impact cell membranes, cell death signaling, and aging [39]. Using asm-3 and hyl-2 mutants, we find that each has a unique lipidome compared to wild type, and each shares a similar lipid profile with other short and longlived C. elegans models of aging, respectively. These findings add to our understanding of lipid changes associated with aging. Sphingolipid changes are observed in lipidomic profiles associated with age, making it an interesting biomarker for aging [19]; in particular, sphingomyelin (SM) abundance is associated with lifespan in several organisms, including C. elegans [2023]. For example, mutants lacking acid sphingomyelinase (asm-3) have longer lifespans [24]. Interestingly, ASM-3 may interact with the DAF-2/insulin-like growth factor receptor, possibly by regulating receptor localization, as loss of asm-3 increased the nuclear localization of the DAF16/FOXO transcription factor that is normally inhibited by DAF-2 [24, 25]. Indeed, further evidence supports that sphingolipids make up a major component of microdomains in cell membranes and may mediate protein localization, including receptor localization [26 28]. Interestingly, specific sphingolipid metabolism enzymes, including sphingomyelinase and ceramidase, may have increased activity during aging in rats [29]. However, it is not clear how changes in sphingolipid metabolic enzymes may impact other sphingolipids and larger lipidomic changes. RESULTS Altering ceramide metabolism affects oxidative stress responses and lipid abundance Previous work has shown that C. elegans with abnormal ceramide metabolism have altered lifespans and stress response. For example, genetic manipulations leading to the loss of hyl-2/CER synthase - which makes ceramide (Figure 1A) - result in shortened lifespans, hypersensitivity to anoxia, and poor survival to heat stress [34, 38, 40]. On the other hand, genetic and pharmacological manipulations that inhibit asm-3/acid sphingomyelinase - which converts sphingomyelin to ceramide - increase lifespan [24, 25]. Here, we explored the age-related response of hyl-2 and asm-3 mutants to oxidative stress induced by juglone (JG). We found that hyl-2 mutants at both young and old ages are more sensitive to oxidative stress compared to wildtype (N2) animals. Specifically, survival of hyl-2 animals exposed to 150M juglone decreased significantly from wildtype Many of the metabolic enzymes that mediate lipid synthesis or breakdown have been linked to stress response and aging in organisms [1]. For example, several genes involved with fatty acid elongation (Elovl5), desaturation (Scd5), and mitochondrial fatty acid synthesis (Mecr and Oxsm) have been identified as targets of natural selection related to increased lifespan in mammals [30]. In C. elegans, fatty acid elongation also seems important for aging [1, 31]. For www.aging-us.com 651 AGING animals at 1 and 10 days of age (Kaplan-Meier estimate and log rank test; p=8.5e-11 and p=0.01455 respectively), while asm-3 mutants did not differ from wildtype animals at either age (p>0.05 for both; Figure 1B). hyl-2 mutants showed a similar response to paraquat (PQ) (Supplementary Figure 1). (p=0.61); contrary, asm-3 animals were not statistically different from N2 on either day. These findings suggest that manipulations in ceramide metabolism may produce broad lipid changes in older animals. Lipidomes of hyl-2 and asm-3 mutants show differential lipid changes Given the links between lipid profiles and aging, we next tested whether loss of hyl-2 or asm-3 altered lipid abundance using Nile red, a stain primarily for neutral lipids such as triglycerides, and may particularly label lysosomal related organelles [41, 42]. We found that 10day old animals had greater Nile red staining compared to their 1-day counterparts (p<0.001 for all genotypes). Comparing across genotypes showed that 10-day hyl-2 mutants had significantly less Nile red staining than N2 animals (p=9.8e-4) but not at the 1-day timepoint To explore specific lipid changes in asm-3 and hyl-2 mutants, we used a lipidomics approach to evaluate changes in specific lipid molecules and classes of lipids. Using shotgun lipidomics by electrospray ionization (ESI) and mass spectrometry, we sampled six independent replicates of 1-, 5-, and 10-day old adult worms of different genotypes. We profiled N2, asm-3, and hyl-2 animals as well as two well-studied mutant models of aging (the short-lived daf-16/FOXO mutant and the Figure 1. Loss of hyl-2/CER synthase results in poor oxidative stress responses. (A) Diagram showing the lipid pathways and metabolic enzymes producing free fatty acids (FFAs) and sphingolipids (SLs). (B) Survival of 1-, 5-, and 10-day old N2 (blue), asm-3 (red), and hyl-2 (green) worms treated with 150M juglone. Worms were treated with juglone in 96 well plates, and survival was determined by a movement response to agitation. Survival curves were analyzed using Kaplan-Meier estimate and pairwise differences were determined using log-rank tests (n=49 for N2 1 day; n=48 for N2 10 day; n=46 for asm-3 1 day; n=35 for asm-3 10 day; n=28 for hyl-2 1 day; n=44 for hyl-2 10 day). (C) Representative images (left) and fluorescence quantification (right) of Nile Red lipid staining in 1-day and 10-day old N2, asm-3, and hyl-2 animals. #indicates p<0.05 compared to 1-day counterpart of the same genotype and *indicates p<0.05 compared to N2 counterpart of the same age. www.aging-us.com 652 AGING long-lived, calorically restricted eat-2/mAChR mutant). Overall, 701 lipids were identified and analyzed covering phosphatidylcholines (PC), phosphatidylethanolamines (PE), lysophosphatidylcholines (LPC), lysophosphatidylethanolamine (LPE), sphingomyelins (SM), cholesterol esters (CE), ceramides (CER), free fatty acids (FFA), diacylglycerols (DAG), and triacylglycerols (TAG). We detected significant differences in class composition between the different strains and age groups compared to 1-day old N2 adults (Supplementary Figure 2). Interestingly, TAG increased in 10-day old animals compared to 1-day old animals in N2, daf-16, and hyl-2 animals. However, this increase was not observed in long-lived eat-2 or asm-3 animals. Overall, we found that our samples had 12.1% FFA, 26.1% TAG, 2.0% DAG, 35.0% PEs, and 16.0% PCs, which is somewhat comparable to that observed in yolk (16.2%, 26.4%, 3.2%, 28.2% and 23%, reference [43]). However, lipid composition is likely to vary by technique and tissue preparation [44]. of lipid profiles regardless of genotype. Interestingly, when analyzing the PCA plots by age, genotypes appear to cluster more closely at 1-day, except daf-16 mutants which appear to cluster away from the rest (Figure 2G, 2H). This visual representation suggests that as animals age, their lipid profile may become more distinct by genotype. Thus, we performed more detailed analysis of specific changes. Next, we determined whether age affected the lipidome within specific classes of lipids. To do this, we visualized lipid concentrations through heatmaps of free fatty acids (FFA) in N2, asm-3, and hyl-2 mutants (Figure 3A). Wildtype N2 animal show decreases in many shorter chained FFAs, particularly saturated FFA. The largest decreases were in FFA(20:0) (log2FC = -2.6, FDR=1.60e-15), FFA(18:0) (log2FC = -2.5, FDR=2.61e-19) (Supplementary Tables 2, 5). This observation is more pronounced in asm-3 mutants. However, hyl-2 mutants show increases in FFA of most types from 1 to 10 days, including many of shorter chained saturated and unsaturated FFAs; this is similar to the short-lived daf-16 mutant. Interestingly, long-lived eat-2 and daf-2 mutants have been shown to have lower amounts of shorter chained fatty acids (C14:0 - C20:0) [6], suggesting that shorter chain FA may contribute to aging. However, very long chain polyunsaturated FFAs increase with age in wildtype animals (Figure 3 and Supplementary Tables 2, 5). The To visualize how age affects lipidome changes, we first examined how well lipidomes clustered by age or genotype using principal components analysis (PCA). For this analysis, raw concentrations of each lipid were log2 transformed and analyzed. We found that within each genotype, animals from each age group clustered most closely with animals from the same age group (Figure 2A2F). This suggests that age is a major driver Figure 2. Age is a major determinant of lipid profiles in C. elegans. Principal component analysis (PCA) graphs show lipid profiles by 1-day (circles), 5-day (cross bars), and 10-day (diamonds). (A) PCA graph showing variation all groups, by strain and age. (BF) PCA graphs showing variations in age by strain (different colors as indicated). (GH) PCA graphs showing variations by 1-day old animals (G) and 10-day old animals (H). www.aging-us.com 653 AGING Figure 3. Lipid profiles vary by age and genotype. Heatmaps showing average z-score of log2 concentration for (A) free fatty acids (FFA), (B) sphingomyelins, and (C) lysophosphatidylcholines (LPCs). For sphingomyelins, the lipid ID does not include the 18:1 fatty acid chain, and LIPIDMAPS nomenclature is reported in Supplementary Table 11. Wildtype, asm-3, eat-2, hyl-2, and daf-16 worms were analyzed at 1-, 5and 10-days old. For all, the heatmaps show averaged z scores for the six replicates in each group. www.aging-us.com 654 AGING largest changes of FFA from 1 day to 10 day N2 were in polyunsaturated FFA(20:2) (log2FC = 2.3, FDR=1.99e-34) and FFA(22:5) (log2FC = 1.30, FDR=1.75e-14). Interestingly, asm-3 mutants exhibit increases in many of the longer chained FFAs at 10 days compared to 1 day (Figure 3A and Supplementary Tables 3, 8). using volcano plots, plotting their concentration to their false discovery rate (FDR, or adjusted p value). Those lipids with greater than a 4-fold change (log2 FC > 2) are highlighted in Figure 4 (and Supplementary Tables 29). First, we examined changes in 10-day old N2 animals compared to 1-day old animals (10d/1d; Figure 4A); many of the lipids that are lower at 10 days compared to 1 day were LPCs, whereas many of the lipids that were higher at 10 days were triacylglycerols (Figure 4A). When examining changes in 5-day old N2 animals compared to 1-day animals, we observed similar changes in triacylglycerols, but not LPCs (Figure 4B). Next, we compared lipidomes of 10-day old animals of hyl-2, asm-3, daf-16, and eat-2 backgrounds to that of wildtype 10-day animals (Figure 4C4F). Strikingly, the lipid changes in asm-3 to N2 were similar to that of the longlived eat-2 to N2. Most of the highly significant changes were found to be lower levels of TAGs. Indeed, eat-2 animals exhibit reduced TAG levels by Nile Red, Oil red O, and Sudan black staining, as well as gas chromatography [46, 47]. On the other hand, the profile of lipid changes in hyl-2 to N2 was similar to that of the short-lived daf-16 to N2. Both 10-day old hyl-2 and daf16 showed increases in LPCs compared to 10-day wildtype, sharing many common LPCs including LPC(16:1), LPC(18:3) and LPC(20:0). We then examined sphingomyelin (SM) profiles and found that, in general, SMs increase with age in N2 animals (Figure 3B and Supplementary Figure 3). This was also found by Cutler et al. (2014) that analyzed SM levels from egg to 11-day adults [25]. However, our analysis was different as we did not directly examine the d17:1 iso-sphingoid base that is most prominent in C. elegans [45]. Of the SMs we identified, we found that asm-3 mutants had higher total SMs compared to N2 at 1 day (p=0.03) but then was lower at 10 days compared to N2 (p<0.00001). In C. elegans, there are three acid sphingomyelinases genes (asm-1, 2, 3) and an uncharacterized neutral sphingomyelinase (T27F6.6). However, their adult expression patterns are unknown, and therefore, the different enzymes may differentially contribute to sphingolipid metabolism and total sphingomyelin levels throughout the worms life. Indeed, asm-1, asm-2, and asm-3 knockdown by RNAi lead to small increases in lifespan independently, and asm-1 and asm-2 knockdown by RNAi can further increase lifespan of asm-3 mutants [24]. Given the changes in LPCs, we visualized differences in LPC levels across all animals in a heatmap (Figure 3C). We find that asm-3 and eat-2 show normal levels of LPCs at younger ages, but have much lower levels of LPCs at 10-days old. On the other hand, hyl-2 and daf16 show increased LPC levels at younger and older ages. In humans, elevated levels of LPCs in circulating low density lipoprotiens (LDLs) are associated with disease [48], and elevated LPC levels are observed in stress conditions, particularly inflammatory disease [49]. Of the SMs we observed, which are more similar to mammalian SMs, the largest increases observed in N2 animals from 1-day to 10-day adults are in several monosaturated sphingomyelins, specifically SM(24:1) (log2FC = 2.6, FDR=2.43e-28), SM(22:1) (log2FC = 1.9, FDR=4.54e-10) and SM(26:1) (log2FC = 1.6, FDR=2.10e-8). Intriguingly, SM(24:1) abundance is low at 1-day in both N2 and hyl-2 mutants, and increases at both 5 and 10-days. However, in asm-3 mutants, SM(24:1) abundance is low at 1-day, increases at 5-days, and then decreases again at 10-days. Furthermore, asm-3 mutants exhibit different 10-to-1 day changes compared to N2; for example, whereas N2 show increases in the saturated sphingomyelins SM(16:0), SM(18:0), SM(22:0), asm-3 show decreases (Supplementary Tables 3, 8). Interestingly, the saturated sphingomyelins SM(16:0) (log2FC=1.9, FDR=2.38e-8), SM(18:0) (log2FC=1.3, FDR=0.026), and SM(22:0) (log2FC=0.47, FDR=0.0293) show even greater increases from 1 to 10 days in hyl-2 mutants than N2. Given the role of SMs on membrane fluidity, these age dependent changes may affect membrane properties in asm-3 and hyl-2 mutants that affect cell physiology. Saturated and unsaturated fatty acid changes in hyl-2/CER synthase and daf-16/FOXO mutants Fatty acid chain desaturation has been of interest in aging because polyunsaturated fatty acids (PUFAs) may be more susceptible to oxidation and cellular damage, suggesting that high levels of PUFAs may be detrimental to health. Indeed, older animals have a decreased monosaturated fatty acid to polyunsaturated fatty acid (MUFA:PUFA) ratio, suggesting that there are more PUFAs, or less MUFAs, with age; in addition, longlived animals generally have a higher MUFA:PUFA ratio compared to short-lived animals [35, 36, 50]. We analyzed TAG and FFA and found that the MUFA:PUFA ratio declined in older ages for all genotypes (Figure 5A). However, when we analyzed total PUFAs, we found that both hyl-2 and daf-16 mutants had higher amounts of PUFAs than 10-day N2 To explore specific lipid changes associated with age, we next examined fold changes of each lipid molecule www.aging-us.com 655 AGING animals (Figure 5B, 3.46 fold and 3.22 fold, p<1.0e-7 respectively). Both hyl-2 and daf-16 had PUFA levels at 1 day comparable to N2, but PUFA levels continued to increase significantly at each timepoint. Both asm-3 and eat-2 had non-significant changes at 10 days compared to N2. The changes in MUFA:PUFA ratio in older animals was not observed when we analyzed saturation levels in PC and PE (Figure 5B). However, we did find that hyl-2 and daf-16 mutants also had increased amounts of saturated lipids found in PC and PE (Figure 5D, 3.96 fold, and 5.28 fold increase respectively; p<1.0e-7 for both). Figure 4. Volcano plots show that specific lipids change by age and genotype. Log2 fold changes between groups are graphed by adjusted P values. Red indicates a greater than 2 log2 fold increase of specific lipid, and blue indicates greater than -2 log2 fold decrease (dashed lines). (A) Comparison of 10-day old N2 animals versus 1-day old N2 animals (10d/1d). 10-day old N2 animals have many decreased LPCs compared to 1-day. (B) Comparison of 5-day old N2 animals versus 1-day old N2 animals. (C) Comparison of 10-day old asm-3 animals versus 10-day old N2 animals. (D) Comparison of 10-day old eat-2 animals versus 10-day old N2 animals. (E) Comparison of 10-day old hyl-2 animals versus 10-day old N2 animals. (F) Comparison of 10-day old daf-16 animals versus 10-day old N2 animals. www.aging-us.com 656 AGING Metabolic enzymes that produce elongated and desaturated fatty acids (Figure 1A) have been implicated in lifespan regulation [1, 13, 17, 31, 50]. Thus, we next explored whether aging affects gene expression of key enzymes in fatty acid lipid metabolism. Fatty acid metabolism starts with the fatty acid synthase FASN-1, which modifies malonyl-CoA to generate either C16 straight chain fatty acids by using Acetyl-CoA, or C13iso-branched fatty acid by using isovalaryl-CoA. From there, C16:0 can be elongated by fatty acid elongases or desaturated by fatty acid desaturases. We examined by qPCR whether elongases or desaturates are regulated by age or by mutations in hyl-2 and asm-3. We found that two fatty acid elongases (elo-1 and elo-2) did not change when comparing 1-day and 10-day old animals of any genotype (Figure 6A and Supplementary Table 10). When then analyzed fatty acid desaturases in the pathway (fat-1, fat-2, fat-4, fat-6, and fat-7). We found that 10-day old animals of all genotypes have very low expression of fat-7, which is a FA desaturase that converts FFA(18:0) to FFA(18:1). We did not observe changes in fat-6 expression or other fatty acid desaturases examined. C13:0iso-branched fatty acid leads to the synthesis of monomethyl branched chain fatty acids (mmBCFA), which are involved in growth and survival [51, 52]. ELO5 and ELO-6 specifically transfer acyl groups to C13iso and C15iso fatty acids [51, 53]. We examined whether there were gene expression changes in elo-5 and elo-6 in 1- and 10-day old N2, hyl-2, and asm-3 animals. Interestingly, elo-5 showed significant decreases in wildtype and hyl-2 animals, and non-significant changes in asm-3 animals (Figure 6A). hyl-2 further shows significant downregulation of elo-6. The downregulation of elo-5 in N2 and asm-3 animals may contribute to the lower levels of FFA(17:0) (Figure 6B). However, it is not clear why hyl-2 mutants exhibit low expression of elo-5 and elo-6 despite sustained levels of FFA(17:0). It is possible some feedback mechanisms exist to decrease their expression, or that early steps in mmBCA synthesis are increased to affect sphingolipid metabolism in hyl-2. Indeed, many sphingomyelin species are higher in 10-day old hyl-2 mutants (Figure 3B) compared to both 1-day hyl-2 or N2 animals. We found that the lipid levels of the FFA(15:0) and FFA(17:0) is increased in 10-day hyl-2 (log2FC=1.28, Figure 5. Analysis of acyl chain saturation during young and old asm-3 and hyl-2 mutants. Chain saturation was analyzed and compared between 1-day (red), 5-day (green), and 10-day (blue) old N2, asm-3, eat-2, hyl-2, and daf-16 animals. Total (A) MUFA:PUFA ratios in TAG and FFA, (B) total polyunsaturated chains in in TAG and FFA, (C) MUFA:PUFA ratios in PC and PE, and (D) saturated PC and PE were summed for each group (n=6). Boxes in graphs represent the middle quartile for the data points in each group. For all, # indicates p<0.05 compared to 1-day counterpart and * indicates p<0.05 compared to N2 counterpart. www.aging-us.com 657 AGING p=1.66e-10; Figure 6B) and daf-16 (log2FC=2.55, p=2.50e-23) mutants compared to N2. On the other hand, asm-3 animals showed decreases in FFA(15:0) and FFA(17:0) (log2FC=-1.98, p=1.10e-18) (Figure 6B). We were interested in whether the differences in these chains are also observed in triacylglycerols (TAGs). When analyzing FA15:0 and FA17:0 chains that are part of TAGs in asm-3 animals, we found that they also exhibited decreased TAGs containing FA15:0 and FA17:0 at 10-day compared to 1-day; hyl-2 mutants showed a general increase in in these TAGs compared to N2, but not in either specific day (Supplementary Figure 4). Although our lipidomics detection could not identify the iso-branched species specifically, this suggests that hyl-2 might have higher mmBCFAs at older ages, whereas asm-3 mutants have lower. addition of fatty acid to C17iso-sphinganine to make dihydroceramide is mediated by hyl-2, as well as other ceramide synthases (Figure 1A). hyl-2 specifically transfers fatty acids of shorter chains (C20-22) [40]. We further explored gene expression changes of hyl-2 and asm-3 itself, and found that asm-3 showed a trend to decrease in N2 animals at 10-days compared to 1-day (Figure 6A). However, we observed that, in general, asm3 had low expression in all genotypes at 10-days. Interestingly, there was a large 10-day to 1-day decrease in asm-3 expression observed in hyl-2 animals. Thus, it is possible that hyl-2 animals, and old animals in general, have reduced breakdown of sphingomyelin at older ages that contribute to their poor stress response and reduced lifespan. However, given that asm-3 mutants have increased lifespan, it is not clear how reduced asm-3 expression at later ages may specifically modify aging processes differently than complete knockouts. Together, these data support a model where increased abundance of sphingolipid precursors and sphingomyelin may contribute to poor aging phenotypes. Indeed, our findings support lipidomic analyses of human longevity suggesting that centenarians upregulate mechanisms to upregulate sphingomyelins to ceramide-containing glycosphingolipids [56, 57]. To determine whether sphingolipid metabolism itself is altered by age, we examined key enzymes in the production of sphingolipids from mmBCFAs. The mmBCFA C15iso and C17iso fatty acids can be made into C17iso-sphinganine or its precursors through serine palmitoyl transferase (sptl-1) in C. elegans (Figure 1A) [54, 55]. We found that sptl-1/serine palmitoyltransferase does not change with age or strain (Figure 6A). The Figure 6. Saturated and polyunsaturated fatty acids metabolism. (A) Table of gene expression for fatty acid for elongases and desaturates examined in 1-day and 10-day old N2, asm-3, and hyl-2 animals by quantitative PCR. Data are represented by 2-ddCT fold change of 10-day N2 compared to 1-day values (n=3 for each group, red indicates fold changes that are p<0.01). The reference gene was rps-2, and rpl-2 and cup-16 are control genes known to remain unchanged and increase, respectively, in older animals. (B) Log2 concentrations of FFA(15:0) and FFA(17:0) are shown at 1- and 10-day old N2, asm-3, and hyl-2 animals (n=6 for each group). For all, #indicates p<0.05 compared to 1-day counterpart of the same genotype. *indicates p<0.05 compared to N2 counterpart of the same age. www.aging-us.com 658 AGING DISCUSSION (ceramide synthases) or recycling through sphingomyelin (sphingomyelinases), have been found to be important for anoxia, autophagy, mitochondrial stress response, locomotion and others in C. elegans [38, 40, 63, 64]. Thus, it is likely that altered activity of enzymes such as ceramide synthases and acid sphingomyelinases serve broad roles in aging physiology. More studies showing direct impact of lipid changes will help elucidate how sphingolipids may mediate cellular processes associated with aging. For example, Wang et al. (2021) show that glucosylceramides mediate clathrin binding to autophagolysosome for lysosome recycling. Furthermore, SM levels and ASM-3 function have been associated with insulin receptors signaling, suggesting that loss of specific SM may reduce or alter receptor abundance or localization [24, 61, 65]. Indeed, Kim and Sun (2012) show that mutations or pharmacological inhibition decreasing asm-3 function increases lifespan and possibly through altered localization of the DAF-2/insulin-like receptors, or downstream targets, that are associated with stress response and aging in worms. However, the specific sphingomyelins species were not examined in these studies, and further characterization of specific carbon length and saturation may provide greater insight into mechanisms of sphingomyelin regulation of aging. On the other hand, studies on Drosophila cpes mutants, which have reduced ceramide phosphoethanolamine (CPE) a structural analog of mammalian sphingomyelin show that CPE has a positive correlation to lifespan increase; specifically, the presence of CPE on glial membranes alters circadian rhythms, glutamate homeostasis and shortens lifespan [66]. Furthermore, sphingolipids on synaptic vesicles have been shown to mediate SNARE proteins and exocytosis [67]. Thus, changes in SMs may alter specific organelle and cell membrane composition that impacts local protein-lipid interactions. Ceramide synthase and sphingomyelinase are enzymes in sphingolipid metabolism that impact sphingomyelin and ceramide levels and aging. We examined lipidomes of mutants for these sphingolipid metabolism enzymes in C. elegans and observed lipid changes that may begin to elucidate how sphingolipid alterations might alter broad lipid composition. We found that hyl-2/CER synthase mutants have poor stress response and have many similar lipidomic changes as the short-lived daf16/FOXO mutant. These include increased total PUFAs and increases in specific LPCs. Conversely, asm-3/acid sphingomyelinase mutants have slight resistance to oxidative stress and have lipidomic changes more similar to the long-lived eat-2/mAChR model. Further analyses of specific lipid changes may provide insight into how these sphingolipid mutants may mediate stress response and aging. As lipid composition changes with age, better understanding of lipid signatures in mutant models may become useful for aging studies. Sphingolipid metabolism changes associated with aging Sphingolipids are gaining attention in their roles in aging but have diverse and complex functions in cells. Sphingomyelins (SM) are among the most prevalent lipids found on cell membranes, and they influence membrane fluidity and cell signaling. We found that most SMs increase with age in general, and asm-3/acid SMase mutants had differing SM profiles than N2. Specifically, 10-day old wild type animals have increased longer chained SMs. While our study did not examine the more abundant d17:1 sphingoid species of SM, our finding supports previous studies of SM changes with age, which show that wildtype animals generally have greater SM elongation (increase C22:0 and C24:0 in 11-day adults compared to 3-day adults) and desaturation (less C18:0) [25]. Longer acyl chained SM create interdigitating acyl chains, which can reduce membrane mobility, and may contribute to the decrease in membrane fluidity observed in aging animals and senescent cells [5860]. Interestingly, blood serum sphingomyelin is elevated with age and is associated with Alzheimers disease [61]. In addition, in the Baltimore longitudinal study, Mielke et al. (2014) found that most SMs increase with age, particularly in female subjects; however, some longer chained saturated SMs (C20:0, C22:0 and C24:0) increase in early aging but may decrease with late age (>70years old) [22]. Saturated sphingomyelins also appear correlated with obesity and insulin resistance [62]. Interestingly, we found that asm-3 gene expression decreases with age, suggesting that sphingomyelin breakdown and broad lipid profiles may change during aging. Indeed, examining SM show that SMs increase with age, and are higher in short-lived animals. However, lipid profiles may be highly specific to the organism, as higher sphingolipid saturation overall was also observed in other long-living species [3]. It is worth noting that there are also race specific effects, as higher levels of sphingomyelins are observed in African Americans and Hispanics when compared to Caucasians [22, 68]. Thus, the changes in SMs are complex, and may involve specific lipids, interactions with other factors and protein functions. Though not definitive, studies suggest that specific sphingomyelins, and enzymes that alter carbon length or saturation, may play important roles in maintaining membrane sphingolipid composition important for many receptors or proteins associated with aging. Why might changes in sphingolipid metabolism cause alterations in adult stress response and lifespan? Ceramides, which can be produced by synthesis www.aging-us.com 659 AGING Fatty acids associated with fat storage and lipid oxidation lived worms also have increases in MUFA:PUFA ratios, suggesting that there are less polyunsaturated fatty acids available for oxidative damage. Indeed, mutations in 9 desaturases (fat-5, fat-6, and fat-7), which produces PUFAs in C. elegans, or supplementation of the PUFA eicosapentaenoic acid (EPA) shortens lifespan [50]. However, -6 PUFAs has also been shown increase autophagy and extend lifespan [81]. This discrepancy is observed elsewhere as a study showed that centenarians increase -3 to -6 PUFAs [82]. Furthermore, long-lived daf-2 mutants have lower expression of fasn-1, a fatty acid synthase important for the initial steps of fatty acid production [83]. This may suggest a downregulation of the metabolic processes associated with fatty acid production, elongation, or desaturation mediates the effects of lipid metabolism on aging. Free fatty acids (FFA) serve roles in both fat storage and membrane lipid composition. Fat storage is important for cellular energy and can change with age, but there is not a direct correlation between lipid levels and lifespan [69]. The dietary restriction mutant model eat-2 has lower fats in storage whereas the insulin signaling model daf2(e1370) has high levels of TAG; yet both are long-lived [37, 41, 6972]. Furthermore, effects may even be genotype dependent, as not all daf-2 mutant alleles share the higher TAG phenotype (Perez and Van Gilst 2008). However, higher TAG have been proposed to contribute to the longer lifespans of animals due to the greater reserve of stored fats for energy utilization in late life [13]. In other model organisms such as yeast, deletion of triglyceride lipases results in increased lipid accumulation as well as increased lifespan [18, 73]. Phylogenomic studies have also identified evolutionary targets that link metabolic enzymes to longevity and include genes with functions in fatty acid elongation and desaturation [30]. We found that age decreases the expression of elo-5, which produces C15iso lipids and is important for development [51]. Interestingly, the long-lived phenotype of daf-2 is somewhat dependent on elo-5 [84]. We found that hyl-2 and daf-16 have increased levels of longer chained PUFAs at 10-days, compared to wildtype animals, suggesting that fatty acid metabolism in these animals may be increased. Shmookler-Reis (2011) also suggests that elongase activity negatively correlates with aging; specifically, the combined regulation for increased 9-desaturase activity to generate MUFAs, and decreased activity of downstream 5-desaturases that generate PUFAs, may correlate with longevity. Lipid droplets (LD) contain stored triacylglycerols, and these TAGs are broken down by enzymes that mediate lipophagy to make free fatty acids [16]. This process may involve autophagy genes as well as the lipase lipl-4 in C. elegans [74, 75]. Indeed, lipl-4 is required for the long lifespan phenotype of daf-2 mutants [76]. Interestingly, glycosphingolipids have recently been shown to mediate clathrin-dependent lysosome formation during autophagy, and increased autophagy in the long-lived hyl-1;lagr-1 ceramide synthase mutants (which produce longer chained ceramides) is abolished by loss of atg-12 [34, 63]. Thus, it is intriguing to speculate that changes in sphingolipid metabolism may mediate membrane dynamics that facilitate lipophagy. Indeed, acid sphingomyelinase (aSMase) is found in lysosomes, and asm-3/acid SMase is involved in lipid storage in embryos and may have roles in general lipid metabolism [77, 78]. However, Nile Red staining, which might more specifically label lysosomal lipids, did not show broad changes in lipids levels. Different methodologies to lipid extractions can yield changes in lipid composition. We note that our protocol called for thawing frozen samples prior to lipidomics sample preparation. This freeze and thaw have been previously done on C. elegans for lipidomics [36, 85], and our quality control does not suggest degradation of any particular class of lipids. However, others have prepped from frozen C. elegans extracts directly [31]. Different tissue treatment conditions can damage tissues and result in elevations in FFA within samples [44]. Thus, total FFA and LPC levels may be impacted by sample preparation methods, although we do not suspect changes in relative values between genotypes emphasized in this analysis. Fatty acids also make up more complex lipids that are part of cell and organelle membranes. The oxidative theory of aging suggests that increased lipids, such as polyunsaturated fatty acids (PUFAs), are more susceptible to oxidation and can lead to cell damage during aging [79, 80]. Indeed, elevated levels of PUFAs appear to increase oxidation and cell damage, and low PUFA levels correlate to longevity in mammals and worms [10, 50]. In C. elegans, PUFAs comprise 46% of total fatty acids of phospholipids but only 12% of triacylglycerols, suggesting that a greater percent of fatty acids is found in phospholipids than triacylglycerols [31]. We found that hyl-2/CER synthase and shorter lived daf-16 have higher amounts of many PUFAs, and this may contribute to their poor lifespan and healthspan in these animals. Many long- www.aging-us.com Lysophosphatidylcholines are increased in shortlived animals High levels of LPCs may mediate cell stress. We found that LPCs were more abundant in short-lived mutants, hyl-2/CER synthase and daf-16/FOXO. LPCs can 660 AGING increase reactive oxygen species in aortic endothelial cells [86]. In addition, osmotic stress was shown to increase the production of LPC through daf-16, and that LPC(18:0) specifically caused osmotic stress mediated embryonic lethality [87]. Furthermore, daf-2/insulinlike receptor mutants exhibit 50% lower levels of LPCs compared to the wild type, including LPC(18:0) and PUFA containing LPCs (20:5, 20:4, and 20:3) [37]. In addition, Rebaudioside A, a sweetener that decreased ROS accumulation and improved oxidative stress response, caused decreased levels of LPC(20:4) and LPC(20:5) [88]. Intriguingly, human studies also show that LPC(20:3) and LPC(20:4) are lower in elderly [19]. On the other hand, others have shown that low levels of LPCs have also been linked to poor mitochondrial function [1]. Together, these data may suggest that regulation of LPC content may mediate mitochondrial function and oxidative stress in animals, and that low or high LPCs may affect healthspan or lifespan. seeded with OP50 E. coli. When progeny reached the L4 stage, animals were washed with M9 and transferred to NGM/OP50 plates supplemented with 50M FUdR. For acute juglone assays, animals were grown to 1-, 5-, and 10-day adults. At these ages, approximately 50 adult worms per genotype were transferred to 150M juglone (Sigma Aldrich) in M9 by placing 10-15 animals per well for 4 wells, in a 96 well plate [89]. Worms were scored for survival every two hours for 8 hours. Animals were considered dead if they did not respond to agitation. Data was analyzed using KaplanMeier estimates and log-rank tests, with Bonferroni correction, in the R statistical package survival and survminer. Nile red staining and imaging To generate a synchronous population of worms, adult N2, hyl-2(gnv1), and asm-3(ok1744) animals were allowed to lay eggs for 4-6 hours on NGM plates seeded with OP50 E. coli. When progeny reached the L4 stage, they were moved onto OP50 E. coli seeded NGM plates supplemented with 50M FUdR. At 1-day or 10-days after the L4 stage, animals stained with Nile Red as previously described previously [42]. Briefly, animals were washed with PBST, incubated in 40% isopropanol of 3 minutes, stained with Nile Red working solution (30g/mL 40% isopropanol) for 2 hours, in the dark, shaking at room temperature. After incubation, worms were washed again with PBST in the dark for 30 minutes and worms were moved to a slide for imaging. Worms were imaged using an ECHO Revolve R4 microscope equipped with Olympus UPlan Fluorite objectives in the FITC/GFP channel. Images were then analyzed using ImageJ version 1.53e [90]. Whole worm fluorescence were used for statistical analysis, accounting for background fluorescence, and values were analyzed by two-way ANOVA and Tukey posthoc tests in the R Statistical Package. In summary, analyzing lipidomes of models of aging has the potential to identify cellular processes and signaling pathways important for animal stress response and aging. We found here that C. elegans hyl-2/CER synthase mutants had a 10-day lipid profile that mirrored shorter lived daf-16/FOXO mutants, which included elevated PUFAs and LPCs. Age caused increased sphingomyelin levels, particularly in shortlived animals. This may suggest that the regulation of sphingolipid metabolism may mediate changes in cell structure and function important for healthy aging. Future studies connecting lipidomic changes in sphingolipid metabolism mutants to mechanistic changes in cells of mutant models will be important next steps to better understanding the roles of sphingolipids in aging. MATERIALS AND METHODS C. elegans strains RNA isolation and real time quantitative polymerase chain reaction All C. elegans were grown on nematode growth media (NGM) at 20 C methods (Stiernagle 2006). Plates were seeded with OP50 E. coli. For lifespan and aging studies, NGM plates were supplemented with 50M 5-Fluoro-2deoxyuridine (FUdR, Alfa Aesar). The following strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440): hyl-2(gnv1), asm-3(ok1744), eat-2(ad1113), and daf-16(mu86). The wildtype strain used was N2 Bristol. All strains were outcrossed at least 4x. N2, hyl-2(gnv1), and asm-3(ok1744) animals were synchronized using a standard egg prep protocol and distributed onto NGM plates supplemented with OP50. Once animals reached the L4 stage, they were transferred to NGM plates supplemented with 50M FUdR and seeded with OP50. Approximately 500 worms per biological replicate were collected at 1 day and 10 days past the L4 stage and flash frozen using liquid nitrogen. RNA was isolated using TRIZOL (Sigma Aldrich) and chloroform extraction and then stored at -80 C. The absorbance at 260/280nm was measured using a NanoDrop Spectrophotometer (Thermo Fisher Scientific) to determine the purity of the RNA. cDNA was generated Oxidative stress assays For stress assays, N2, hyl-2(gnv-1), and asm-3(ok1744) animals were synchronized via egg lay on NGM plates www.aging-us.com 661 AGING from ~500ng/L of total RNA using the QuantiNova Reverse Transcription Kit (Qiagen). In the first step of the cDNA synthesis, all RNA was treated with a gDNA removal step to remove gDNA contamination. Quantitative, real-time polymerase chain reaction was performed in triplicate using the QuantiNova SYBR Green PCR Kit and Rotor Gene Q (Qiagen). mRNA fold changes were calculated using ddCT method (Wu, Tian et al. 2020). mRNA levels of the genes of interest were compared with the mRNA levels of the reference gene rps-2. Gene expression by qPCR was repeated with biological replicates and three technical replicates. All qPCR primers (Supplementary Table 1) were designed to be intron spanning, and one primer from each set was intron bridging to reduce the likelihood of gDNA amplification. Data were analyzed by two-way ANOVA and Tukey post-hoc tests in the R Statistical Package. (DMS). 1-propanol was used as the chemical modifier for the DMS. Samples were introduced to the mass spectrometer by flow injection analysis at 8 L/min. Each sample was injected twice, once with the DMS on (PC/PE/LPC/LPE/SM), and once with the DMS off (CE/ CER/DAG/DCER/FFA/HCER/ LCER/TAG). The lipid molecular species were measured using multiple reaction monitoring (MRM) and positive/negative polarity switching. A total of 1070 lipids and fatty acids were targeted in the analysis. Using 54 internal standards previously used and described in [92], quantities (in mol/g) of each lipid species could be calculated. Data were acquired and processed using Analyst 1.6.3 and Lipidomics Workflow Manager 1.0.5.0. Data processing and statistical analyses Statistical analysis was carried out using R (version 3.6.0). The targeted lipidomic assay was designed to detect 1070 lipid species. Data were in concentration per worm weight (nmol/g of worm tissue (M)), and therefore no further normalization was performed prior to statistical analysis. Only lipids in which missing data across all groups were less than 20% were included in further analysis. Out of the possible 1071 lipid species that the assay could detect, 701 lipids passed these filtering criteria and were included in further analysis. We used a quantile regression approach for the imputation of left-censored missing data (QRILC), which has been suggested as the favored imputation method for left-censored MNAR data [93]. This was implemented in the R imputeLCMD package. Sample preparation for lipidomics Approximately 1000 C. elegans worms were synchronized by treating gravid adults with an alkaline hypochlorite solution (bleach/NaOH). Worms were then grown to L4 stage and transferred to NGM agar plates containing 50M FUdR. Worms were then collected after 1, 5, and 10 days. Six replicate samples of each group were then sent for lipidomics analysis at the Northwest Metabolomics Research Center (University of Washington). C. elegans samples were prepared as described (Hanson et al., 2020). Briefly, frozen worm samples were thawed and vortexed; 250L of worm slurry was transferred to a borosilicate glass culture tube (16 100 mm). Next, 250L of water, 1 mL of methanol, and 450L of dichloromethane were added to all samples. Then, 25L of the isotope labeled internal standards mixture were added and incubated at room temperature for 30 min. Next, another 500L of water and 450L of dichloromethane were added to the tube and centrifuged at 2500g at 15 C for 10 min. The bottom organic layer was transferred to a new tube and 900L of dichloromethane was added to the original tube for a second extraction. The combined extracts were concentrated under nitrogen and reconstituted in 250L of the running solution (10mM ammonium acetate in 50:50 methanol:dichloromethane). We fit linear models to the lipidomic data using the Bioconductor limma package [94] to assess the difference in abundance between experimental groups. The limma package uses empirical Bayes moderated statistics, which improves power by borrowing strength between features in order to moderate the residual variance [95]). We selected lipids with a false discovery rate (FDR) of 5%. In the heatmaps, z-scores are calculated by adjusting the data, by feature, to have a mean of zero and a standard deviation of 1. The heatmaps were generated using the R statistical package. For direct comparisons of specific lipids between strains, log2 concentrations were compared between samples using a two-way ANOVA and Tukey post hoc analyses in the R statistical package. Mass spectrometry AUTHOR CONTRIBUTIONS C. elegans samples were analyzed as described by [91] and completed at the Northwest Metabolomics Research Center. Briefly, Quantitative lipidomics was performed with the Sciex Lipidyzer platform consisting of a Sciex QTRAP 5500 mass spectrometer equipped with SelexION for differential mobility spectrometry www.aging-us.com JC conceived all experiments, collected and analyzed data, and wrote and edited the manuscript. TS and GM performed qPCR experiments and edited the manuscript. TS had additional roles in conceiving the 662 AGING experimental design and analyzing data. JR performed lipidomics sample collection, LB and DR performed sample preparations for lipid mass spectrometry, LW performed lipidomic analyses, and AK, GM, MG, MP, and SB performed physiological experiments. 5. Han X, Rozen S, Boyle SH, Hellegers C, Cheng H, Burke JR, Welsh-Bohmer KA, Doraiswamy PM, KaddurahDaouk R. Metabolomics in early Alzheimers disease: identification of altered plasma sphingolipidome using shotgun lipidomics. PLoS One. 2011; 6:e21643. https://doi.org/10.1371/journal.pone.0021643 PMID:21779331 6. Hu C, Kong H, Qu F, Li Y, Yu Z, Gao P, Peng S, Xu G. Application of plasma lipidomics in studying the response of patients with essential hypertension to antihypertensive drug therapy. Mol Biosyst. 2011; 7:32719. https://doi.org/10.1039/c1mb05342f PMID:22009255 7. Naud A, Cabr R, Jov M, Ayala V, Gonzalo H, PorteroOtn M, Ferrer I, Pamplona R. Lipidomics of human brain aging and Alzheimers disease pathology. Int Rev Neurobiol. 2015; 122:13389. https://doi.org/10.1016/bs.irn.2015.05.008 PMID:26358893 8. Stoessel D, Schulte C, Teixeira Dos Santos MC, Scheller D, Rebollo-Mesa I, Deuschle C, Walther D, Schauer N, Berg D, Nogueira da Costa A, Maetzler W. Promising Metabolite Profiles in the Plasma and CSF of Early Clinical Parkinsons Disease. Front Aging Neurosci. 2018; 10:51. https://doi.org/10.3389/fnagi.2018.00051 PMID:29556190 9. Meikle TG, Huynh K, Giles C, Meikle PJ. Clinical lipidomics: realizing the potential of lipid profiling. J Lipid Res. 2021; 62:100127. https://doi.org/10.1016/j.jlr.2021.100127 PMID:34582882 ACKNOWLEDGMENTS We would like to thank Daniel Promislow and the Nathan Shock Center at the University of Washington for their support. We would like to thank the CGC for strains in this paper. CONFLICTS OF INTEREST The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflicts of interest. FUNDING Work was supported by the National Institutes of Aging (R15AG052933-03). Lipidomic analysis was further supported by the Nathan Shock Center grant (P30 AG013280) and an instrumentation grant (S10OD021562) to the Northwest Metabolomics Research Center. REFERENCES 1. 2. 3. 4. Johnson AA, Stolzing A. The role of lipid metabolism in aging, lifespan regulation, and age-related disease. Aging Cell. 2019; 18:e13048. https://doi.org/10.1111/acel.13048 PMID:31560163 10. Jov M, Naud A, Aledo JC, Cabr R, Ayala V, PorteroOtin M, Barja G, Pamplona R. Plasma long-chain free fatty acids predict mammalian longevity. Sci Rep. 2013; 3:3346. https://doi.org/10.1038/srep03346 PMID:24284984 Jov M, Mota-Martorell N, Pradas I, Galo-Licona JD, Martn-Gari M, Obis , Sol J, Pamplona R. The Lipidome Fingerprint of Longevity. Molecules. 2020; 25:4343. https://doi.org/10.3390/molecules25184343 PMID:32971886 11. Jov M, Naud A, Gambini J, Borras C, Cabr R, PorteroOtn M, Via J, Pamplona R. A Stress-Resistant Lipidomic Signature Confers Extreme Longevity to Humans. J Gerontol A Biol Sci Med Sci. 2017; 72:307. https://doi.org/10.1093/gerona/glw048 PMID:27013396 Bozek K, Khrameeva EE, Reznick J, Omerbai D, Bennett NC, Lewin GR, Azpurua J, Gorbunova V, Seluanov A, Regnard P, Wanert F, Marchal J, Pifferi F, et al. Lipidome determinants of maximal lifespan in mammals. Sci Rep. 2017; 7:5. https://doi.org/10.1038/s41598-017-00037-7 PMID:28127055 12. Almeida I, Magalhes S, Nunes A. Lipids: biomarkers of healthy aging. Biogerontology. 2021; 22:27395. https://doi.org/10.1007/s10522-021-09921-2 PMID:33837874 Graessler J, Schwudke D, Schwarz PE, Herzog R, Shevchenko A, Bornstein SR. Top-down lipidomics reveals ether lipid deficiency in blood plasma of hypertensive patients. PLoS One. 2009; 4:e6261. https://doi.org/10.1371/journal.pone.0006261 PMID:19603071 www.aging-us.com 13. Mutlu AS, Duffy J, Wang MC. Lipid metabolism and lipid signals in aging and longevity. Dev Cell. 2021; 56:1394407. https://doi.org/10.1016/j.devcel.2021.03.034 PMID:33891896 663 AGING 14. Pamplona R. Membrane phospholipids, lipoxidative damage and molecular integrity: a causal role in aging and longevity. Biochim Biophys Acta. 2008; 1777:124962. https://doi.org/10.1016/j.bbabio.2008.07.003 PMID:18721793 https://doi.org/10.1111/acel.12275 PMID:25345489 23. Braun F, Rinschen MM, Bartels V, Frommolt P, Habermann B, Hoeijmakers JH, Schumacher B, Doll ME, Mller RU, Benzing T, Schermer B, Kurschat CE. Altered lipid metabolism in the aging kidney identified by three layered omic analysis. Aging (Albany NY). 2016; 8:44157. https://doi.org/10.18632/aging.100900 PMID:26886165 15. Hansen M, Flatt T, Aguilaniu H. Reproduction, fat metabolism, and life span: what is the connection? Cell Metab. 2013; 17:109. https://doi.org/10.1016/j.cmet.2012.12.003 PMID:23312280 24. Kim Y, Sun H. ASM-3 acid sphingomyelinase functions as a positive regulator of the DAF-2/AGE-1 signaling pathway and serves as a novel anti-aging target. PLoS One. 2012; 7:e45890. https://doi.org/10.1371/journal.pone.0045890 PMID:23049887 16. Kounakis K, Chaniotakis M, Markaki M, Tavernarakis N. Emerging Roles of Lipophagy in Health and Disease. Front Cell Dev Biol. 2019; 7:185. https://doi.org/10.3389/fcell.2019.00185 PMID:31552248 25. Cutler RG, Thompson KW, Camandola S, Mack KT, Mattson MP. Sphingolipid metabolism regulates development and lifespan in Caenorhabditis elegans. Mech Ageing Dev. 2014; 143:918. https://doi.org/10.1016/j.mad.2014.11.002 PMID:25437839 17. Bustos V, Partridge L. Good Ol Fat: Links between Lipid Signaling and Longevity. Trends Biochem Sci. 2017; 42:81223. https://doi.org/10.1016/j.tibs.2017.07.001 PMID:28802547 18. Li X, Handee W, Kuo MH. The slim, the fat, and the obese: guess who lives the longest? Curr Genet. 2017; 63:439. https://doi.org/10.1007/s00294-016-0617-z PMID:27230908 26. Cutler RG, Mattson MP. Sphingomyelin and ceramide as regulators of development and lifespan. Mech Ageing Dev. 2001; 122:895908. https://doi.org/10.1016/s0047-6374(01)00246-9 PMID:11348657 19. Yang S, Dong Y, Liu Y, Yan X, Sun G, Jia G, Li X, Liu H, Su H, Li Y. Application of lipidomics strategy to explore aging-related biomarkers and potential antiaging mechanisms of ginseng. Biogerontology. 2021; 22:589602. https://doi.org/10.1007/s10522-021-09937-8 PMID:34542790 27. Hannun YA, Obeid LM. Principles of bioactive lipid signalling: lessons from sphingolipids. Nat Rev Mol Cell Biol. 2008; 9:13950. https://doi.org/10.1038/nrm2329 PMID:18216770 28. Bieberich E. Sphingolipids and lipid rafts: Novel concepts and methods of analysis. Chem Phys Lipids. 2018; 216:11431. https://doi.org/10.1016/j.chemphyslip.2018.08.003 PMID:30194926 20. Gonzalez-Covarrubias V, Beekman M, Uh HW, Dane A, Troost J, Paliukhovich I, van der Kloet FM, HouwingDuistermaat J, Vreeken RJ, Hankemeier T, Slagboom EP. Lipidomics of familial longevity. Aging Cell. 2013; 12:42634. https://doi.org/10.1111/acel.12064 PMID:23451766 29. Sacket SJ, Chung HY, Okajima F, Im DS. Increase in sphingolipid catabolic enzyme activity during aging. Acta Pharmacol Sin. 2009; 30:145461. https://doi.org/10.1038/aps.2009.136 PMID:19749786 21. Montoliu I, Scherer M, Beguelin F, DaSilva L, Mari D, Salvioli S, Martin FP, Capri M, Bucci L, Ostan R, Garagnani P, Monti D, Biagi E, et al. Serum profiling of healthy aging identifies phospho- and sphingolipid species as markers of human longevity. Aging (Albany NY). 2014; 6:925. https://doi.org/10.18632/aging.100630 PMID:24457528 30. Jobson RW, Nabholz B, Galtier N. An evolutionary genome scan for longevity-related natural selection in mammals. Mol Biol Evol. 2010; 27:8407. https://doi.org/10.1093/molbev/msp293 PMID:19955481 31. Brock TJ, Browse J, Watts JL. Fatty acid desaturation and the regulation of adiposity in Caenorhabditis elegans. Genetics. 2007; 176:86575. https://doi.org/10.1534/genetics.107.071860 PMID:17435249 22. Mielke MM, Bandaru VV, Han D, An Y, Resnick SM, Ferrucci L, Haughey NJ. Factors affecting longitudinal trajectories of plasma sphingomyelins: the Baltimore Longitudinal Study of Aging. Aging Cell. 2015; 14:11221. www.aging-us.com 664 AGING 32. Obeid LM, Hannun YA. Ceramide, stress, and a LAG in aging. Sci Aging Knowledge Environ. 2003; 2003:PE27. https://doi.org/10.1126/sageke.2003.39.pe27 PMID:14523222 41. ORourke EJ, Soukas AA, Carr CE, Ruvkun G. C. elegans major fats are stored in vesicles distinct from lysosome-related organelles. Cell Metab. 2009; 10:4305. https://doi.org/10.1016/j.cmet.2009.10.002 PMID:19883620 33. Kraut R. Roles of sphingolipids in Drosophila development and disease. J Neurochem. 2011; 116:76478. https://doi.org/10.1111/j.1471-4159.2010.07022.x PMID:21214556 42. Escorcia W, Ruter DL, Nhan J, Curran SP. Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining. J Vis Exp. 2018; 57352. https://doi.org/10.3791/57352 PMID:29553519 34. Mosbech MB, Kruse R, Harvald EB, Olsen AS, Gallego SF, Hannibal-Bach HK, Ejsing CS, Frgeman NJ. Functional loss of two ceramide synthases elicits autophagy-dependent lifespan extension in C. elegans. PLoS One. 2013; 8:e70087. https://doi.org/10.1371/journal.pone.0070087 PMID:23894595 43. Kubagawa HM, Watts JL, Corrigan C, Edmonds JW, Sztul E, Browse J, Miller MA. Oocyte signals derived from polyunsaturated fatty acids control sperm recruitment in vivo. Nat Cell Biol. 2006; 8:11438. https://doi.org/10.1038/ncb1476 PMID:16998478 44. Christie WW. Preparation of lipid extracts from tissues. 1993. 35. Schroeder EA, Brunet A. Lipid Profiles and Signals for Long Life. Trends Endocrinol Metab. 2015; 26:58992. https://doi.org/10.1016/j.tem.2015.08.007 PMID:26439976 45. Hnel V, Pendleton C, Witting M. The sphingolipidome of the model organism Caenorhabditis elegans. Chem Phys Lipids. 2019; 222:1522. https://doi.org/10.1016/j.chemphyslip.2019.04.009 PMID:31028715 36. Wan QL, Yang ZL, Zhou XG, Ding AJ, Pu YZ, Luo HR, Wu GS. The Effects of Age and Reproduction on the Lipidome of Caenorhabditis elegans. Oxid Med Cell Longev. 2019; 2019:5768953. https://doi.org/10.1155/2019/5768953 PMID:31249646 46. Brooks KK, Liang B, Watts JL. The influence of bacterial diet on fat storage in C. elegans. PLoS One. 2009; 4:e7545. https://doi.org/10.1371/journal.pone.0007545 PMID:19844570 37. Prasain JK, Wilson L, Hoang HD, Moore R, Miller MA. Comparative Lipidomics of Caenorhabditis elegans Metabolic Disease Models by SWATH Non-Targeted Tandem Mass Spectrometry. Metabolites. 2015; 5:67796. https://doi.org/10.3390/metabo5040677 PMID:26569325 47. Bar DZ, Charar C, Dorfman J, Yadid T, Tafforeau L, Lafontaine DL, Gruenbaum Y. Cell size and fat content of dietary-restricted Caenorhabditis elegans are regulated by ATX-2, an mTOR repressor. Proc Natl Acad Sci USA. 2016; 113:E46209. https://doi.org/10.1073/pnas.1512156113 PMID:27457958 38. Chan JP, Brown J, Hark B, Nolan A, Servello D, Hrobuchak H, Staab TA. Loss of Sphingosine Kinase Alters Life History Traits and Locomotor Function in Caenorhabditis elegans. Front Genet. 2017; 8:132. https://doi.org/10.3389/fgene.2017.00132 PMID:28983319 48. Law SH, Chan ML, Marathe GK, Parveen F, Chen CH, Ke LY. An Updated Review of Lysophosphatidylcholine Metabolism in Human Diseases. Int J Mol Sci. 2019; 20:1149. https://doi.org/10.3390/ijms20051149 PMID:30845751 39. Hannun YA, Obeid LM. Sphingolipids and their metabolism in physiology and disease. Nat Rev Mol Cell Biol. 2018; 19:17591. https://doi.org/10.1038/nrm.2017.107 PMID:29165427 49. Engel KM, Schiller J, Galuska CE, Fuchs B. Phospholipases and Reactive Oxygen Species Derived Lipid Biomarkers in Healthy and Diseased Humans and Animals - A Focus on Lysophosphatidylcholine. Front Physiol. 2021; 12:732319. https://doi.org/10.3389/fphys.2021.732319 PMID:34858200 40. Menuz V, Howell KS, Gentina S, Epstein S, Riezman I, Fornallaz-Mulhauser M, Hengartner MO, Gomez M, Riezman H, Martinou JC. Protection of C. elegans from anoxia by HYL-2 ceramide synthase. Science. 2009; 324:3814. https://doi.org/10.1126/science.1168532 PMID:19372430 www.aging-us.com 50. Shmookler Reis RJ, Xu L, Lee H, Chae M, Thaden JJ, Bharill P, Tazearslan C, Siegel E, Alla R, Zimniak P, Ayyadevara S. Modulation of lipid biosynthesis 665 AGING contributes to stress resistance and longevity of C. elegans mutants. Aging (Albany NY). 2011; 3:12547. https://doi.org/10.18632/aging.100275 PMID:21386131 https://doi.org/10.1016/0047-6374(89)90103-6 PMID:2630834 60. Wi JH, Heo CH, Gwak H, Jung C, Kim SY. Probing Physical Properties of the Cellular Membrane in Senescent Cells by Fluorescence Imaging. J Phys Chem B. 2021; 125:1018294. https://doi.org/10.1021/acs.jpcb.1c05403 PMID:34473497 51. Kniazeva M, Crawford QT, Seiber M, Wang CY, Han M. Monomethyl branched-chain fatty acids play an essential role in Caenorhabditis elegans development. PLoS Biol. 2004; 2:E257. https://doi.org/10.1371/journal.pbio.0020257 PMID:15340492 61. Jko H, Stpie A, Lukiw WJ, Strosznajder RP. The Cross-Talk Between Sphingolipids and Insulin-Like Growth Factor Signaling: Significance for Aging and Neurodegeneration. Mol Neurobiol. 2019; 56:350121. https://doi.org/10.1007/s12035-018-1286-3 PMID:30140974 52. Kniazeva M, Euler T, Han M. A branched-chain fatty acid is involved in post-embryonic growth control in parallel to the insulin receptor pathway and its biosynthesis is feedback-regulated in C. elegans. Genes Dev. 2008; 22:210210. https://doi.org/10.1101/gad.1692008 PMID:18676815 62. Hanamatsu H, Ohnishi S, Sakai S, Yuyama K, Mitsutake S, Takeda H, Hashino S, Igarashi Y. Altered levels of serum sphingomyelin and ceramide containing distinct acyl chains in young obese adults. Nutr Diabetes. 2014; 4:e141. https://doi.org/10.1038/nutd.2014.38 PMID:25329603 53. Watts JL, Ristow M. Lipid and Carbohydrate Metabolism in Caenorhabditis elegans. Genetics. 2017; 207:41346. https://doi.org/10.1534/genetics.117.300106 PMID:28978773 63. Wang F, Dai Y, Zhu X, Chen Q, Zhu H, Zhou B, Tang H, Pang S. Saturated very long chain fatty acid configures glycosphingolipid for lysosome homeostasis in longlived C. elegans. Nat Commun. 2021; 12:5073. https://doi.org/10.1038/s41467-021-25398-6 PMID:34417467 54. Hannich JT, Mellal D, Feng S, Zumbuehl A, Riezman H. Structure and conserved function of iso-branched sphingoid bases from the nematode Caenorhabditis elegans. Chem Sci. 2017; 8:367686. https://doi.org/10.1039/c6sc04831e PMID:30155209 55. Deng X, Kolesnick R. Caenorhabditis elegans as a model to study sphingolipid signaling. Biol Chem. 2015; 396:76773. https://doi.org/10.1515/hsz-2014-0298 PMID:25720116 64. Govindan JA, Jayamani E, Zhang X, Breen P, LarkinsFord J, Mylonakis E, Ruvkun G. Lipid signalling couples translational surveillance to systemic detoxification in Caenorhabditis elegans. Nat Cell Biol. 2015; 17:1294303. https://doi.org/10.1038/ncb3229 PMID:26322678 56. Barbacini P, Torretta E, Arosio B, Ferri E, Capitanio D, Moriggi M, Gelfi C. Novel Insight into the Serum Sphingolipid Fingerprint Characterizing Longevity. Int J Mol Sci. 2022; 23:2428. https://doi.org/10.3390/ijms23052428 PMID:35269570 65. Li Z, Zhang H, Liu J, Liang CP, Li Y, Li Y, Teitelman G, Beyer T, Bui HH, Peake DA, Zhang Y, Sanders PE, Kuo MS, et al. Reducing plasma membrane sphingomyelin increases insulin sensitivity. Mol Cell Biol. 2011; 31:420518. https://doi.org/10.1128/MCB.05893-11 PMID:21844222 57. Pradas I, Jov M, Huynh K, Ingles M, Borras C, MotaMartorell N, Galo-Licona JD, Puig J, Via J, Meikle PJ, Pamplona R. Long-lived Humans Have a Unique Plasma Sphingolipidome. J Gerontol A Biol Sci Med Sci. 2022; 77:72835. https://doi.org/10.1093/gerona/glab360 PMID:34871393 66. Chen X, Li J, Gao Z, Yang Y, Kuang W, Dong Y, Chua GH, Huang X, Jiang B, Tian H, Wang Y, Huang X, Li Y, et al. Endogenous ceramide phosphoethanolamine modulates circadian rhythm via neural-glial coupling in Drosophila. Natl Sci Rev. 2022; 9:nwac148. https://doi.org/10.1093/nsr/nwac148 PMID:36713590 58. Chiantia S, London E. Acyl chain length and saturation modulate interleaflet coupling in asymmetric bilayers: effects on dynamics and structural order. Biophys J. 2012; 103:23119. https://doi.org/10.1016/j.bpj.2012.10.033 PMID:23283230 67. Darios F, Wasser C, Shakirzyanova A, Giniatullin A, Goodman K, Munoz-Bravo JL, Raingo J, Jorgacevski J, Kreft M, Zorec R, Rosa JM, Gandia L, Gutirrez LM, et al. Sphingosine facilitates SNARE complex assembly and activates synaptic vesicle exocytosis. Neuron. 2009; 62:68394. 59. Wahnon R, Mokady S, Cogan U. Age and membrane fluidity. Mech Ageing Dev. 1989; 50:24955. www.aging-us.com 666 AGING https://doi.org/10.1016/j.neuron.2009.04.024 PMID:19524527 77. Jenkins RW, Canals D, Hannun YA. Roles and regulation of secretory and lysosomal acid sphingomyelinase. Cell Signal. 2009; 21:83646. https://doi.org/10.1016/j.cellsig.2009.01.026 PMID:19385042 68. Nelson JC, Jiang XC, Tabas I, Tall A, Shea S. Plasma sphingomyelin and subclinical atherosclerosis: findings from the multi-ethnic study of atherosclerosis. Am J Epidemiol. 2006; 163:90312. https://doi.org/10.1093/aje/kwj140 PMID:16611667 78. Schmkel V, Memar N, Wiekenberg A, Trotzmller M, Schnabel R, Dring F. Genetics of Lipid-Storage Management in Caenorhabditis elegans Embryos. Genetics. 2016; 202:107183. https://doi.org/10.1534/genetics.115.179127 PMID:26773047 69. Ackerman D, Gems D. The mystery of C. elegans aging: an emerging role for fat. Distant parallels between C. elegans aging and metabolic syndrome? Bioessays. 2012; 34:46671. https://doi.org/10.1002/bies.201100189 PMID:22371137 79. Wolff S, Dillin A. The trifecta of aging in Caenorhabditis elegans. Exp Gerontol. 2006; 41:894903. https://doi.org/10.1016/j.exger.2006.06.054 PMID:16919905 70. Shi X, Li J, Zou X, Greggain J, Rdkr SV, Frgeman NJ, Liang B, Watts JL. Regulation of lipid droplet size and phospholipid composition by stearoyl-CoA desaturase. J Lipid Res. 2013; 54:250414. https://doi.org/10.1194/jlr.M039669 PMID:23787165 80. Liguori I, Russo G, Curcio F, Bulli G, Aran L, Della-Morte D, Gargiulo G, Testa G, Cacciatore F, Bonaduce D, Abete P. Oxidative stress, aging, and diseases. Clin Interv Aging. 2018; 13:75772. https://doi.org/10.2147/CIA.S158513 PMID:29731617 71. Vrablik TL, Petyuk VA, Larson EM, Smith RD, Watts JL. Lipidomic and proteomic analysis of Caenorhabditis elegans lipid droplets and identification of ACS-4 as a lipid droplet-associated protein. Biochim Biophys Acta. 2015; 1851:133745. https://doi.org/10.1016/j.bbalip.2015.06.004 PMID:26121959 81. ORourke EJ, Kuballa P, Xavier R, Ruvkun G. -6 Polyunsaturated fatty acids extend life span through the activation of autophagy. Genes Dev. 2013; 27:42940. https://doi.org/10.1101/gad.205294.112 PMID:23392608 72. Berg M, Zhou XY, Shapira M. Host-Specific Functional Significance of Caenorhabditis Gut Commensals. Front Microbiol. 2016; 7:1622. https://doi.org/10.3389/fmicb.2016.01622 PMID:27799924 82. Rabini RA, Moretti N, Staffolani R, Salvolini E, Nanetti L, Franceschi C, Mazzanti L. Reduced susceptibility to peroxidation of erythrocyte plasma membranes from centenarians. Exp Gerontol. 2002; 37:65763. https://doi.org/10.1016/s0531-5565(02)00006-2 PMID:11909683 73. Handee W, Li X, Hall KW, Deng X, Li P, Benning C, Williams BL, Kuo MH. An Energy-Independent Prolongevity Function of Triacylglycerol in Yeast. PLoS Genet. 2016; 12:e1005878. https://doi.org/10.1371/journal.pgen.1005878 PMID:26907989 83. Depuydt G, Xie F, Petyuk VA, Smolders A, Brewer HM, Camp DG 2nd, Smith RD, Braeckman BP. LC-MS proteomics analysis of the insulin/IGF-1-deficient Caenorhabditis elegans daf-2(e1370) mutant reveals extensive restructuring of intermediary metabolism. J Proteome Res. 2014; 13:193856. https://doi.org/10.1021/pr401081b PMID:24555535 74. Lapierre LR, Silvestrini MJ, Nuez L, Ames K, Wong S, Le TT, Hansen M, Melndez A. Autophagy genes are required for normal lipid levels in C. elegans. Autophagy. 2013; 9:27886. https://doi.org/10.4161/auto.22930 PMID:23321914 84. Samuelson AV, Carr CE, Ruvkun G. Gene activities that mediate increased life span of C. elegans insulin-like signaling mutants. Genes Dev. 2007; 21:297694. https://doi.org/10.1101/gad.1588907 PMID:18006689 75. Yang P, Zhang H. You are what you eat: multifaceted functions of autophagy during C. elegans development. Cell Res. 2014; 24:8091. https://doi.org/10.1038/cr.2013.154 PMID:24296782 85. Cheng X, Jiang X, Tam KY, Li G, Zheng J, Zhang H. Sphingolipidomic Analysis of C. elegans reveals Development- and Environment-dependent Metabolic Features. Int J Biol Sci. 2019; 15:289710. https://doi.org/10.7150/ijbs.30499 PMID:31853226 76. Lapierre LR, Gelino S, Melndez A, Hansen M. Autophagy and lipid metabolism coordinately modulate life span in germline-less C. elegans. Curr Biol. 2011; 21:150714. https://doi.org/10.1016/j.cub.2011.07.042 PMID:21906946 www.aging-us.com 86. Zou Y, Kim DH, Jung KJ, Heo HS, Kim CH, Baik HS, Yu BP, Yokozawa T, Chung HY. Lysophosphatidylcholine enhances oxidative stress via the 5-lipoxygenase 667 AGING pathway in rat aorta during aging. Rejuvenation Res. 2009; 12:1524. https://doi.org/10.1089/rej.2008.0807 PMID:19226207 https://doi.org/10.1007/s11306-019-1627-x PMID:31832778 87. Burton NO, Dwivedi VK, Burkhart KB, Kaplan RE, Baugh LR, Horvitz HR. Neurohormonal signaling via a sulfotransferase antagonizes insulin-like signaling to regulate a Caenorhabditis elegans stress response. Nat Commun. 2018; 9:5152. https://doi.org/10.1038/s41467-018-07640-w PMID:30514845 92. Ghorasaini M, Mohammed Y, Adamski J, Bettcher L, Bowden JA, Cabruja M, Contrepois K, Ellenberger M, Gajera B, Haid M, Hornburg D, Hunter C, Jones CM, et al. Cross-Laboratory Standardization of Preclinical Lipidomics Using Differential Mobility Spectrometry and Multiple Reaction Monitoring. Anal Chem. 2021; 93:1636978. https://doi.org/10.1021/acs.analchem.1c02826 PMID:34859676 88. Li P, Wang Z, Lam SM, Shui G. Rebaudioside A Enhances Resistance to Oxidative Stress and Extends Lifespan and Healthspan in Caenorhabditis elegans. Antioxidants (Basel). 2021; 10:262. https://doi.org/10.3390/antiox10020262 PMID:33567712 93. Wei R, Wang J, Su M, Jia E, Chen S, Chen T, Ni Y. Missing Value Imputation Approach for Mass Spectrometry-based Metabolomics Data. Sci Rep. 2018; 8:663. https://doi.org/10.1038/s41598-017-19120-0 PMID:29330539 89. Possik E, Pause A. Measuring oxidative stress resistance of Caenorhabditis elegans in 96-well microtiter plates. J Vis Exp. 2015; e52746. https://doi.org/10.3791/52746 PMID:25993260 94. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015; 43:e47. https://doi.org/10.1093/nar/gkv007 PMID:25605792 90. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012; 9:67175. https://doi.org/10.1038/nmeth.2089 PMID:22930834 95. Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol. 2004; 3:Article3. https://doi.org/10.2202/1544-6115.1027 PMID:16646809 91. Hanson AJ, Banks WA, Bettcher LF, Pepin R, Raftery D, Craft S. Cerebrospinal fluid lipidomics: effects of an intravenous triglyceride infusion and apoE status. Metabolomics. 2019; 16:6. www.aging-us.com 668 AGING SUPPLEMENTARY MATERIALS Supplementary Figures Supplementary Figure 1. hyl-2/ceramide synthase animals show poor response to paraquat. (A) Survival of 1-, 5-, and 10-day old N2 (blue), asm-3 (red), and hyl-2 (green) worms exposed to 100M paraquat. Worms were treated with paraquat in 96 well plates, and response to agitation was recorded every two hours to determine survival. Each group was done in 6 replicates of 10 worms each. Supplementary Figure 2. Lipid class composition changes as animals age. The percentages were calculated as the proportion of the total lipids (nmol/g of worm tissue (M)) in each class divided by total lipids in the group. The percentages were then compared to the 1-day N2 animals (* indicates p<0.05 compared to N2_1d). Each 5- and 10- day was also compared to the 1-day group for each strain (# indicates p<0.05 compared to 1d counterpart). Comparisons were performed using Chi Sq analyses. www.aging-us.com 669 AGING Supplementary Figure 3. Sphingomyelin changes by age in sphingolipid mutants. The boxplots show log2 concentrations of respective sphingolipids in N2 (N), asm-3/acid sphingomyelinase (A) and hyl-2/ceramide synthase (H) animals. For sphingomyelins, the lipid ID does not include the 18:1 fatty acid chain, and LIPIDMAPS nomenclature is reported in Supplementary table 11. For all, n=6 and * indicates p<0.05 compared only to N2 animals of the same age (ANOVA and Tukey-HSD tests). Supplementary Figure 4. Triacylglyercols containing FA15:0 and FA17:0 are increased in asm-3/acid sphingomyelinase mutants. Total Log2 concentrations of TAG containing FA(15:0) and FA(17:0) chains were summed for 1- and 10-day old N2, asm-3, and hyl-2 animals (n=6 for each group). When comparing N2 and asm-3, there was a significant difference between TAGs containing FA15:0 and FA17:0, and pairwise analyses show significant differences between 10-day concentrations (p<0.000001 for FA15:0 and p<0.000001 for FA17:0) but not 1-day concentrations. For comparisons between N2 and hyl-2, there was also a significant difference between N2 and hyl-2 animals, but pairwise analysis did not show significant differences between 10-day concentrations (p=0.93 for FA15:0 and p=0.11 for FA17:0). For all, #indicates p<0.05 compared to 1-day counterpart of the same genotype. *indicates p<0.05 compared to N2 counterpart of the same age. www.aging-us.com 670 AGING Supplementary Tables Please browse Full Text version to see the data of Supplementary Tables 2, 3, 4, 5, 7, 8, 9. Supplemental Table 1. Primer sequences for genes used in qPCR. Gene elo-1 Forward Reverse elo-2 Forward Reverse elo-5 Forward Reverse elo-6 Forward Reverse fat-1 Forward Reverse fat-4 Forward Reverse fat-6 Forward Reverse fat-7 Forward Reverse cup-16 Forward Reverse rpl-2 Forward Reverse hyl-2 Forward Reverse sptl-1 Forward Reverse sphk-1 Forward Reverse rpl-2 Forward Reverse fat-2 Forward Rreverse www.aging-us.com Primer sequence (3 - 5) CAGTTGGCATTGGTGAAGTGC CCAGGATTCAACAGATACGGA GGGTTTGTCGCTTCCTACTG TCAGAGTATGTGACTACTGCG ATGCACTGGTACCATCACGC ATGGCAACTGCGAATTGAACC AACCATTTGATCTCACGGGACC CACGGCTGAAGAACTCGTGG CTTCACCATGCTTTCACCAACC CCGAATAAAGTGTACACTGGG GGAGAAGTTTGCATTGAGCTCG TGTGTCGTGGCATCGTTGG TCTGATCTCTTGAGTGACCC ATCCGAAATAGTGAGCAGCG ACGGCCGTCTTCTCATTTGCT TGGCAACGATGATCACGAGC TCGAAGAGAGCACTTAACGGC GCAGATGTTTCAGCGCCTATT TGTGGAGCTAAGGCTCAAATC CGTTGCAGATGGTGGTTCCTT GACCAGAAGGGGAACACTGG CGAGAGCAATGTAGAATCCTCC GAAGAGGAGTCACCGAGCA CCGTTGCAAGAAGAGGTGG ATTCGCAGCTGCAATCTCCG GAATCTGACACGGATCCATTCG TGTGGAGCTAAGGCTCAAATC CGTTGCAGATGGTGGTTCCTT GGATATTGAGGTCTACGAAGC AAGTGATGGGCGACGTGAC 671 AGING Supplemental Table 2. Lipid fold changes between wild type (N2) 10-day and 1-day old animals. Supplemental Table 3. Lipid fold changes between 10-day N2 and 10-day asm-3 animals. Supplemental Table 4. Lipid fold changes between 10-day N2 and 10-day hyl-2 animals. Supplemental Table 5. Lipid fold changes between 5-day N2 and 1-day N2 animals. Supplemental Table 6. Lipid fold changes between 10-day N2 and 10-day eat-2 animals. Lipid TAG44:1-FA14:1 TAG46:3-FA14:0 TAG45:0-FA15:0 TAG46:2-FA18:2 TAG44:0-FA12:0 TAG50:2-FA20:2 TAG46:0-FA18:0 TAG42:0-FA14:0 TAG48:4-FA14:1 TAG50:4-FA14:1 TAG46:1-FA14:1 TAG46:0-FA12:0 TAG52:2-FA20:2 TAG44:3-FA18:2 TAG48:3-FA18:3 TAG47:0-FA15:0 TAG48:2-FA18:2 TAG46:2-FA14:1 TAG44:1-FA18:1 TAG50:1-FA20:1 TAG46:3-FA18:2 TAG50:5-FA18:2 TAG47:0-FA17:0 TAG45:1-FA15:0 TAG42:1-FA14:0 TAG48:1-FA14:1 TAG46:1-FA16:1 TAG47:2-FA18:2 LPE(20:4) CE(20:4) PE(18:1/18:4) LPC(20:0) PE(18:0/18:4) www.aging-us.com LogFC -5.05071 -3.11684 -2.75904 -2.73781 -2.72853 -2.67452 -2.66131 -2.65593 -2.5399 -2.51176 -2.50983 -2.46487 -2.3372 -2.3253 -2.3128 -2.29485 -2.2154 -2.2092 -2.19892 -2.19501 -2.18545 -2.16965 -2.16637 -2.15197 -2.10766 -2.09764 -2.08682 -2.05378 2.002917 2.058696 2.116137 2.15351 2.728121 P.Value 3.27E-22 0.00000000000068 2.37E-24 0.000000000000293 0.00000000717 1.62E-20 0.0000000038 0.000276 0.0000000000000000196 1.06E-18 1.31E-19 0.00000682 7.3E-19 0.000000872 0.00000000000125 1.48E-19 0.0000000000000000539 0.0000000000000000208 0.00000000000134 0.0000000000000000525 0.0000000000000115 0.0000000114 6.85E-18 0.000000000000000234 0.0000854 0.0000000000000000525 0.0000000000000133 0.00000000000000278 0.00000000413 0.00000147 0.00000333 0.003403 0.00000000124 672 FDR 1.15E-19 0.0000000000144 1.66E-21 0.00000000000684 0.0000000529 2.84E-18 0.0000000296 0.000759 0.00000000000000132 0.0000000000000000932 0.0000000000000000173 0.000027 0.0000000000000000731 0.00000413 0.0000000000237 0.0000000000000000173 0.0000000000000027 0.00000000000000132 0.0000000000247 0.0000000000000027 0.000000000000424 0.0000000813 0.000000000000000534 0.000000000000011 0.000259 0.0000000000000027 0.000000000000465 0.000000000000122 0.0000000318 0.00000647 0.000014 0.007454 0.0000000108 AGING Supplemental Table 7. Lipid changes between 10-day N2 and 10-day daf-16 animals. Supplemental Table 8. Comparative lipid changes between 10- and 1-day asm-3 animals vs 10- and 1-day N2 animals. Supplemental Table 9. Comparative lipid changes between 10- and 1-day hyl2 animals ve 10- and 1-day N2 animals. Supplemental Table 10. Relative gene expression and fold change values from RT-qPCR analyses of 10-day and 1-day WT, asm-3 and hyl-2 animals. 1day 10day Gene Animal 2ddCT SEofdiff rpl-2 rpl-2 rpl-2 elo-5 elo-5 elo-5 elo-6 elo-6 elo-6 elo-1 elo-1 elo-1 elo-2 elo-2 elo-2 fat-1 fat-1 fat-1 fat-2 fat-2 fat-2 fat-4 fat-4 fat-4 fat-6 fat-6 fat-6 fat-7 fat-7 fat-7 asm-3 asm-3 asm-3 hyl-2 hyl-2 hyl-2 cup-16 cup-16 cup-16 sptl-1 sptl-1 sptl-1 sphk-1 sphk-1 sphk-1 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 N2 hyl-2 asm-3 1 1.21 0.94 1 2.05 1.22 1 1.74 1.41 1 0.71 1.14 1 0.45 2 1 1.21 0.94 1 1.18 0.69 1 1.29 0.8 1 1.37 0.8 1 0.81 0.46 1 2.33 0.37 0.28 0.4 0.75 0.54 0.61 0.7 0.48 0.41 0.33 0.27 0.48 0.35 0.39 0.49 0.37 0.28 0.4 0.67 0.67 0.58 0.41 0.49 0.45 0.7 0.75 0.77 0.69 0.69 0.72 0.69 0.72 1 0.77 1.29 1 0.76 0.81 1 1.42 1.46 1 1.09 1.11 0.66 0.4 0.59 0.53 0.94 0.93 0.62 0.59 0.78 0.64 www.aging-us.com p value (vs N2) n/a 0.984 1 n/a 0.902 0.232 n/a 0.501 0.867 n/a 0.696 0.993 n/a 0.182 0.293 n/a 0.753 0.998 n/a 0.683 0.998 n/a 0.863 0.803 n/a 0.83 1 n/a 0.968 0.516 n/a 0.762 n/a n/a n/a 0.992 n/a 0.949 0.984 n/a 0.987 0.982 n/a 1 1 10day/1day 2ddCT SE 1.12 1.28 1.56 0.24 0.42 0.54 0.39 0.34 0.7 0.96 1.23 1.47 0.44 1.01 1.03 1.12 1.28 1.56 0.63 0.86 1.25 0.81 0.91 1.72 0.44 0.87 1 0.04 0.01 0.03 0.2 0.07 0.35 0.38 0.69 0.5 0.33 0.75 0.51 0.51 0.64 0.65 0.63 0.72 0.63 1 0.72 0.35 0.38 0.69 0.71 0.71 0.64 0.48 0.5 0.66 0.66 0.91 0.93 0.63 0.79 0.8 1.1 1.2 3 0.93 4.13 11.26 17.35 22.01 1.17 0.99 2.51 1.08 1.57 3.25 0.84 0.87 0.77 0.79 1.13 1.04 0.9 0.8 0.9 0.79 673 p value (vs N2) n/a 0.997 0.865 n/a 0.149 0.496 n/a 0.997 0.44 n/a 0.881 0.488 n/a 0.15 0.142 n/a 0.995 0.735 n/a 0.865 0.361 n/a 0.996 0.056 n/a 0.316 0.616 n/a 0 0.201 n/a 0.666 n/a n/a n/a 0.979 n/a 0.764 0.366 n/a 1 0.747 n/a 0.919 0.116 FC log2FC p value 1.32 1.03 1.74 -4.13 -4.92 -2.25 -2.57 -5.13 -2.01 -1.04 1.73 1.29 -2.27 2.24 -1.95 1.12 1.06 1.66 0.63 0.73 1.81 -1.23 -1.43 2.16 0.44 0.64 1.25 0.04 0.01 0.07 -4.91 -33.51 0.17 0.08 0.73 -2.05 -2.3 -1.17 -1.36 -2.36 -1.01 -0.06 0.79 0.37 -1.18 1.16 -0.96 0.17 0.08 0.73 -0.67 -0.46 0.86 -0.3 -0.51 1.11 -1.18 -0.66 0.32 -4.64 -6.34 -3.94 -2.3 -5.07 0.998 1 0.542 0.005 0.002 0.144 0.081 0.002 0.276 1 0.245 0.873 0.161 0.17 0.327 0.923 0.43 1 1 0.998 0.667 0.936 0.637 0.049 0.669 0.993 1 0 0 0 0.226 0.01 3 1.58 0.241 3.2 11.26 22.94 27.22 1.17 0.7 1.73 1.077 1.441 2.915 1.68 3.49 4.52 4.77 0.23 -0.52 0.79 0.11 0.53 1.54 0.196 0 0 0 1 0.985 0.919 1 0.928 0.133 AGING Supplementary Table 11. LIPIDMAPS and common names of sphingolipids examined. 1 2 3 4 5 6 7 8 9 10 11 12 www.aging-us.com ID SM(14:0) SM(16:0) SM(18:0) SM(18:1) SM(20:0) SM(20:1) SM(22:0) SM(22:1) SM(24:0) SM(24:1) SM(26:0) SM(26:1) HMDB HMDB12097 HMDB10169 HMDB01348 HMDB12101 HMDB12102 HMDB12103 HMDB12104 HMDB11697 HMDB12107 HMDB11698 - LIPIDMAPS LMSP03010028 LMSP03010003 LMSP03010001 LMSP03010029 LMSP03010005 LMSP03010059 LMSP03010006 LMSP03010072 LMSP03010008 LMSP03010007 LMSP03010010 LMSP03010009 674 Common name SM(d18:1/14:0) SM(d18:1/16:0) SM(d18:1/18:0) SM(d18:1/18:1(9Z)) SM(d18:1/20:0) SM(d18:1/20:1) SM(d18:1/22:0) SM(d18:1/22:1) SM(d18:1/24:0) SM(d18:1/24:1(15Z)) SM(d18:1/26:0) SM(d18:1/26:1(17Z)) AGING  ...

... 4/5/2023 - Open Access The impact of C. elegans ceramide glucosyltransferase enzymes on the beneficial effects of B. subtilis lifespan Chelsey L Arvin 1, Zachary Sibila 2, Regina Lamendella 3, Jason Chan 2, Trisha Staab 2 1Marian University College of Osteopathic Medicine, Indianapolis, Indiana, USA 2Marian University College of Arts and Sciences, Indianapolis, Indiana, USA 3Biology, Juniata College, Huntingdon, Pennsylvania, USA To whom correspondence should be addressed: tstaab@marian.edu Abstract Ceramide glucosyltransferase (CGT) adds sugar moieties to ceramide, forming glucosylceramides that play roles in immune signaling, stress response, and host-bacterial interactions. Here, we examined whether mutations in cgt block the beneficial effects of Bacillus subtilis on C. elegans lifespan. We found that loss of cgt-1 or cgt-3 reduces lifespan compared to wildtype worms, but did not prevent the lifespan-extending phenotype of B. subtilis. However, cgt-1(ok1045) and cgt-3(tm504) did play a minor role in blocking stress resistance of 5-day old worms treated with B. subtilis. Further studying CGTs may elucidate potential roles of glucosylceramides in host-bacterial interaction. 4/5/2023 - Open Access Figure 1. Loss of CGT does not impair the beneficial effects of B. subtilis: A) Survival curves of wild-type (N2) and cgt mutants (cgt-1(tm1027), cgt-1(ok1045), cgt-2(tm1192), cgt-3(tm504)) fed on E. coli (OP50; yellow) or B. subtilis (3A1T; blue). Worms were tracked for lifespan starting at L4 stage (day 0) and scored every 2 days. Bagged or missing worms were censored (indicated by a crossline). Significant differences were found between survival of animals treated with E. coli vs B. subtilis. The bottom right panel in (A) shows the survival curves of all animals fed E. coli (OP50) on the same graph. B) Table showing sample size, mean, standard error deviation, & median values for the lifespans of worms grown on the control bacteria (E. coli) and experimental bacteria (B. subtilis). For B, * indicates significant difference compared to the respective animal on B. subtilis and # indicates significant difference compared to N2 on E. coli. C) Acute stress response survival curves of wild-type (N2) and cgt mutants treated with 100mM paraquat. Experiments were performed on 1-day, 5-day, and 10-day old animals. Worms were grown to respective ages on either E.coli (OP50; yellow) or B. subtilis (3A1T; blue) bacterial lawns prior to the stress test. For all, survival curves were analyzed using Kaplan-Meier estimates, and pairwise comparisons were performed using a log-rank test. Description At the membrane surface of intestinal cells, there is a rich complement of glucosylceramides. Ceramides are a type of sphingolipid that play a role in lipid microdomains, stress response, and cell death (Rohrhofer et al. 2021). The enzyme ceramide glucosyltransferase (CGT) catalyzes the addition of sugar moieties onto ceramide in the lipid bilayer. However, it is not known how bacteria-host interactions are affected by glucosylceramide metabolism. Could the presence of different cgt enzymes affect the impact of the beneficial effects of bacteria on the host physiology? There are three genes (cgt-1, cgt-2, and cgt-3) that are thought to have CGT enzymatic activity in C. elegans. Previous studies suggest that cgt-1 and cgt-3 have a greater number of amino acids relating to functional enzymatic activity; thus, mutations in cgt-1 and cgt-3 may have more of a negative impact on animal physiology than cgt-2 (Marza et al. 2009). Specifically, cgt-1;cgt-3 double mutants have larval phenotypes, cgt-1 and cgt-3 are highly expressed in the worm intestine, and they are known to serve developmental roles; furthermore, loss of all cgts (cgt-1, cgt-2, and cgt-3) are lethal (Marza et al. 2009). Re-expression of cgt enzymes in the intestine can rescue larval phenotypes of cgt-1;cgt-3 double mutants, suggesting CGTs have important intestinal functions (Marza et al. 2009). CGTs have also been shown to help establish intestinal cell polarity during development (Zhang et al. 2011). More recently, there has been observation of CGTs acting on autophagolysosomes to recruit clathrin and mediate lysosome recycling (Wang et al. 2021). The commensal bacteria Bacillus subtilis has been demonstrated to increase lifespan and promote survival to the oxidative stressor juglone and thermotolerance of the nematode Caenorhabditis elegans (Donato et al. 2017; Smolentseva et al. 2017). Interestingly, these effects were dependent on the biofilm forming nature of B. subtilis. Biofilms are protective structures composed of extracellular matrix proteins and signaling molecules, providing a place for bacteria to grow and survive (Vlamakis et al. 2013). It also acts as a point of contact between bacteria and the host intestinal membrane. However, less is known about whether glucosylceramides mediate the beneficial effects of B. subtilis. Recent studies show that glycosylated ceramides are targets of Bacillus thuringiensis binding, leading to C. elegans infection (Griffitts et al. 2005). Furthermore, CGT inhibition can weaken the colon cell barrier to the Bacteroides fragilis toxin (Patterson et al. 2020). Given the effect of B. subtilis on stress response and lifespan, along with the roles of cgt enzymes in the intestine, we aimed to examine whether the protective effects of B. subtilis require cgt enzymes (cgt-1, cgt-2, and cgt-3). To do this, we compared lifespan and stress response of wild-type and mutant animals when grown on either the B. subtilis wild-type isolate (3AIT) or the common lab bacteria E. coli (OP50). First, we found that B. subtilis increased the survival of wild-type animals approximately 10% (Figure 1A), which is similar to the 15% increased survival demonstrated in other studies (Donato et al. 2017). However, B. subtilis also increased the survival of all cgt mutant animals examined. When comparing wild-type animals to cgt mutants on OP50, we found that mutations in cgt-1 and cgt-3 reduced lifespan compared to wild-type (Figure 1A,B). Similarly, Wang et al. (2021) found that cgt-3 RNAi reduced lifespan. Whereas loss of particular ceramide glucosyltransferase genes can reduce lifespan, it does not block the beneficial effects of the commensal bacteria B. subtilis. However, it is not clear how specific cgt manipulations may affect total levels of glucosylceramides. Indeed, one study showed that only double-knockout mutants (cgt-3;cgt-1) demonstrated observable phenotypes (Marza et al. 2009); but, another showed pharmacological inhibition of glucosylceramides, particularly glucosylceramide transferase 2, actually increase lifespan (Cutler et al. 2014). Furthermore, the enzymes may have location- specific cell functions that have not been explored. Previously, it was found that wild-type B. subtilis can promote tolerance to heavy metal, osmotic, oxidative, pathogenic, and temperature stress (Donato et al. 2017; Smolentseva et al. 2017). To examine the effect of mutations in cgt enzymes on adult stress response, we performed an oxidative stress assay by examining acute survival to the oxidative stressor paraquat (PQ) in 1, 5, and 10 day old animals. We found that wild-type N2 worms fed B. subtilis performed worse in response to 100mM PQ at 4/5/2023 - Open Access 1-day old than N2 worms fed OP50 (Figure 1C). This was also observed in cgt-1(tm1027) mutants. However, 5-day-old N2 worms fed B. subtilis improved acute survival to PQ compared to those who fed OP50 (p=0.007; Figure 1C); however, this effect was not observed at 10-days of age. The improved response to PQ in 5-day old wild-type animals was not observed in the presence of cgt mutations. In summary, we show that loss of individual CGTs impact does not block the lifespan extending effects of the bacteria B. subtilis. Prior research demonstrates that single CGT knockouts may play a minor role in C. elegans response to stress (Marza et al. 2009). However, others have found that cgt-3 RNAi alone can reduce survival to the oxidative stressor TBHP (Wang et al. 2021). Thus, further experiments deleting or knocking down multiple CGTs may provide further insight into the roles of glucosylceramides in host-bacterial interactions. It was interesting that there were some differences between 1 day and 5 day responses of wild-type animals fed OP50 vs B. subtilis to PQ (from a slightly detrimental effect to a slightly beneficial effect), which may suggest that colonization of B. subtilis is needed to impact hosts. Although speculative, this finding supports the model that biofilm formation in B. subtilis is necessary to promote host lifespan and physiology (Donato et al. 2017; Smolentseva et al. 2017). Nevertheless, our data suggests that CGTs may play minor roles in the beneficial effects of the commensal bacteria B. subtilis, unlike findings from pathogenic bacteria. Future work examining how sphingolipid enzymes affect intestinal membranes may inform our understanding of how bacteria, including those that form biofilms, impact host physiology. Methods Strains. Wild-type N2 animals were obtained from the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). Mutants for cgt-1(tm1027), cgt-2(tm1192), cgt-3(tm504) were obtained from the Mitani lab at the National BioResource Project and cgt-1(ok1045) was obtained from the Caenorhabditis Genetics Center (CGC). Strains were not backcrossed into lab strains of N2. All tm strains are thought to eliminate CGT function or enzymatic activity (Marza et al. 2009). ok1045 is a large ~1800 deletion spanning 7 exons (Wormbase). All worms were maintained on Nematode Growth Medium (Stiernagle 2006) and maintained at 20 on respective bacteria. Gene Name Allele Sequence Name Strain Source cgt-1 tm1027 T06C12.10 JPC21 NBRC cgt-1 ok1045 T06C12.10 JPC22 CGC cgt-2 tm1192 F20B4.6 JPC23 NBRC cgt-3 tm504 F59G1.1 JPC24 NBRC N2 CGC wildtype Bacterial cultures. E. coli was obtained from the CGC and B. subtilis from the Bacillus Genetic Stock Center (BGSC). To make E. coli cultures, a single isolate of E. coli OP50 was inoculated in LB broth and incubated at 37. When the OD was around 0.5 (approximately 24 hours), the solution was stored at 4C. For B. subtilis cultures, a single isolate of B. subtilis (3AIT) was inoculated nutrient broth and incubated at 32 with 125 RPM shaking. When the OD was around 0.5 (approximately 48 hours), the solution was stored at 4C. Both OP50 and 3AIT bacteria were seeded on NGM or NGM plates supplemented with 50M FUdR. Lifespan Assay. L4 animals were placed on NGM plates supplemented with 50 M FUdR. Lifespan measurements were made every two days and bagged/missing worms were censored on corresponding days. The plates were kept at 20 . Animals were transferred to new 50 M FUdR NGM plates with their respective bacteria every four days. Statistical tests for lifespan were analyzed using Kaplan-Meier survival estimates and log-rank tests, with Bonferroni correction, in the R (version 4.0) statistical package survival (version 3.5-0) and survminer (version 0.4.9). Acute Paraquat Assay. N2 and cgt mutants at L4 stage were placed onto 50 M FUdR NGM plates seeded with either E. coli (OP50) or B. subtilis (3AIT) and kept at 20. On days 1 (24 hours after L4), 5 and 10, around 60 animals of each group were transferred into 15 L of M9 buffer in a 96 well plate (10 animals per well in six replicates). Fifteen microliters of 200 mM paraquat were then added for a final test concentration of 100 mM paraquat in each well. Animals in each well were checked 4/5/2023 - Open Access for survival every 30 minutes, for five hours. Survival was determined by movement to gentle prodding. Statistical tests for survival to PQ were analyzed using Kaplan-Meier estimates and log-rank tests, with Bonferroni correction, in the R (version 4.0) statistical package survival (version 3.5-0) and survminer (version 0.4.9). Reagents Product Product Number Source paraquat 856177 Sigma FUdR F0503 Sigma References Cutler RG, Thompson KW, Camandola S, Mack KT, Mattson MP. 2014. Sphingolipid metabolism regulates development and lifespan in Caenorhabditis elegans. Mechanisms of Ageing and Development 143-144: 9-18. PubMed ID: 25437839 C. elegans Deletion Mutant Consortium. 2012. Large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2: 1415-25. PubMed ID: 23173093 Donato V, Ayala FR, Cogliati S, Bauman C, Costa JG, Leini C, Grau R. 2017. Bacillus subtilis biofilm extends Caenorhabditis elegans longevity through downregulation of the insulin-like signalling pathway. Nat Commun 8: 14332. PubMed ID: 28134244 Griffitts JS, Haslam SM, Yang T, Garczynski SF, Mulloy B, Morris H, et al., Aroian RV. 2005. Glycolipids as receptors for bacillus thuringiensis crystal toxin. Science. 307(5711):922-925. PubMed ID: 15705852 Marza E, Simonsen KT, Faergeman NJ, Lesa GM. 2009. Expression of ceramide glucosyltransferases, which are essential for glycosphingolipid synthesis, is only required in a small subset of C. elegans cells. J Cell Sci 122: 822-33. PubMed ID: 19240113 Patterson L, Allen J, Posey I, Shaw JJP, Costa-Pinheiro P, Walker SJ, et al., Kester M. 2020. Glucosylceramide production maintains colon integrity in response to Bacteroides fragilis toxin-induced colon epithelial cell signaling. FASEB J 34: 1592215945. PubMed ID: 33047400 Rohrhofer J, Zwirzitz B, Selberherr E, Untersmayr E. 2021. The Impact of Dietary Sphingolipids on Intestinal Microbiota and Gastrointestinal Immune Homeostasis. Front Immunol 12: 635704. PubMed ID: 34054805 Smolentseva O, Gusarov I, Gautier L, Shamovsky I, DeFrancesco AS, Losick R, Nudler E. 2017. Mechanism of biofilmmediated stress resistance and lifespan extension in C. elegans. Sci Rep 7: 7137. PubMed ID: 28769037 Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 1-11. PubMed ID: 18050451 Vlamakis H, Chai Y, Beauregard P, Losick R, Kolter R. 2013. Sticking together: building a biofilm the Bacillus subtilis way. Nat Rev Microbiol 11: 157-68. PubMed ID: 23353768 Wang F, Dai Y, Zhu X, Chen Q, Zhu H, Zhou B, Tang H, Pang S. 2021. Saturated very long chain fatty acid configures glycosphingolipid for lysosome homeostasis in long-lived C. elegans. Nat Commun 12: 5073. PubMed ID: 34417467 Zhang H, Abraham N, Khan LA, Hall DH, Fleming JT, Gbel V. 2011. Apicobasal domain identities of expanding tubular membranes depend on glycosphingolipid biosynthesis. Nat Cell Biol 13: 1189-201. PubMed ID: 21926990 Funding: This work was supported by R15AG063103 and R15AG052933 grants. Author Contributions: Chelsey L Arvin : conceptualization, data curation, formal analysis, investigation, methodology, project administration, resources, validation, visualization, writing - original draft, writing - review editing. Zachary Sibila : conceptualization, data curation, formal analysis, investigation, methodology, project administration, resources, validation, visualization, writing - original draft, writing - review editing. Regina Lamendella : conceptualization. Jason Chan : conceptualization, data curation, formal analysis, funding acquisition, investigation, methodology, project administration, resources, software, supervision, validation, visualization, writing - original draft, writing - review editing. Trisha Staab : conceptualization, project administration, resources, writing - review editing, supervision. Reviewed By: Anonymous, Michelle Mondoux 4/5/2023 - Open Access History: Received January 27, 2023 Revision Received March 28, 2023 Accepted April 3, 2023 Published Online April 5, 2023 Indexed April 19, 2023 Copyright: 2023 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Citation: Arvin , CL; Sibila , Z; Lamendella , R; Chan , J; Staab , T (2023). The impact of C. elegans ceramide glucosyltransferase enzymes on the beneficial effects of B. subtilis lifespan. microPublication Biology. 10.17912/micropub.biology.000758  ...

... Running head: SPINAL INDUCED HYPOTENSION PROPHYLAXIS 1 Marian University Leighton School of Nursing Doctor of Nursing Practice Final Project Report for Students Graduating in May 2024 Spinal Induced Hypotension Prophylaxis: Indiana CRNA Techniques Kristen M. Thomas Marian University Leighton School of Nursing Chair: Dr. Marie Goez, DNP, CRNA (Signature) Project Team Member: Dr. Mary Nguyen Reynolds, DNP, CRNA (Signature) Date of Submission: August 29th, 2023 2 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Table of Contents Abstract....................................................................................................................................... 4 Introduction ................................................................................................................................ 5 Background ........................................................................................................................... 6 Problem Statement ................................................................................................................ 7 Needs Assessment and Gap Analysis..................................................................................... 7 Review of the Literature .............................................................................................................. 8 Synthesis of Literature Review .............................................................................................. 8 Practice Guidelines ................................................................................................................ 9 Crystalloid or Colloid Pre-loading or Co-loading ................................................................. 10 Norepinephrine .................................................................................................................... 10 Ondansetron and Granisetron ............................................................................................... 11 Lower Extremity Elevation or Compression ......................................................................... 12 Decreased Local Anesthetic Spinal Dosing .......................................................................... 13 Glycopyrrolate ..................................................................................................................... 13 Discussion ........................................................................................................................... 13 Theoretical Framework ............................................................................................................. 14 Project Aims and Objectives ...................................................................................................... 15 Project Design and Methods ...................................................................................................... 15 Project Site and Population.................................................................................................. 16 3 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Measurement Instrument ..................................................................................................... 16 Data Collection Procedure ................................................................................................... 16 Ethical Considerations ......................................................................................................... 17 Results ...................................................................................................................................... 17 Participant SIH Background and Prophylaxis ...................................................................... 18 Qualitative Results .............................................................................................................. 20 Graphed Results .................................................................................................................. 21 Discussion ................................................................................................................................. 21 Limitations.......................................................................................................................... 22 Conclusion ................................................................................................................................ 22 References................................................................................................................................. 24 Appendices................................................................................................................................ 28 Appendix A......................................................................................................................... 29 Appendix B ......................................................................................................................... 30 Appendix C ......................................................................................................................... 40 Appendix D ......................................................................................................................... 41 Appendix E ......................................................................................................................... 43 4 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Abstract Anesthesia providers who give spinal anesthetics in obstetric anesthesia commonly witness spinal induced hypotension (SIH) in patients due to the sympathetic blockade after injection. This DNP project evaluated Indiana Certified Registered Nurse Anesthetists (CRNAs) and their utilization of preventative treatment for SIH after the administration of spinal anesthesia in healthy pregnant women undergoing elective cesarean sections. A needs assessment depicted a lack of research specifically concerning Indiana CRNAs and their prophylaxis practices when addressing SIH. This project design was a descriptive study and yielded a 13.27% response rate. By utilizing the Indiana Association of Nurse Anesthetists (INANA) email contact list of five hundred and sixty-five (565) members, an information sheet including implied consent, and an anonymous link to a 7-question Qualtrics self-assessment survey was administered. Survey questions included general demographics, prevention options, and treatment options utilized to prevent SIH in obstetrics. The select all that apply survey question regarding SIH prophylactic and rescue methods resulted in 296 responses from 75 Indiana CRNAs. After conducting data analysis, the most common practices of these 75 Indiana CRNAs were exposed. Data collection and analysis indicated the following results: 71 CRNAs reported administering an intravenous crystalloid infusion to reduce SIH (23.99%), 52 CRNAs reported administering intravenous ondansetron (17.58%), 48 CRNAs reported administering ephedrine boluses (16.22%), 47 CRNAs reported administering phenylephrine boluses (15.88%), and 37 CRNAs reported decreasing the height-based dosing of their spinal anesthetic (12.5%). This project assesses Indiana CRNA approaches to reduce SIH compared to current, published anesthesia practice guidelines. Keywords: spinal anesthesia, hypotension, cesarean, prevention 5 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Spinal Induced Hypotension Prophylaxis: Indiana CRNA Techniques Spinal anesthesia is a standard anesthetic plan of choice utilized when caring for a healthy pregnant woman who is delivering via elective, scheduled cesarean section (Noffsinger, 2022). Spinal induced hypotension (SIH) arises due to a profound preganglionic sympathetic blockade after injection and direct vasodilation from the effects of local anesthetics (Noffsinger, 2022). The sympathetic blockade occurs due to the dense sensory neuraxial block required for cesarean sections, reaching up to the fourth thoracic dermatome level (T4) (Noffsinger, 2022). During this sympathetic response and peripheral vasodilation, there is a decrease in venous return and cardiac output leading to hypotension (Noffsinger, 2022). Pregnant women also have physiologic changes that leave them more susceptible to hypotension than non-pregnant women, including aortocaval compression from a gravid uterus and an increase in sympathetic tone (Noffsinger, 2022). Compared to non-pregnant women, pregnant women have a higher sympathetic tone and proliferation of vasodilatory prostaglandins make them less responsive to vasopressors (Noffsinger, 2022). Hypotension in this patient population can lead to nausea, vomiting, and, more importantly, decreased uteroplacental perfusion, leading to fetal distress (Noffsinger, 2022). There are several prophylactic techniques used in anesthesia today to decrease the incidence of SIH in this patient population, including administration of crystalloids, administration of colloids, prophylactic phenylephrine infusions with additional bolus doses of phenylephrine or ephedrine, prophylactic IV ondansetron, a decrease in local anesthetic dosing, and lower limb compression stockings (Noffsinger, 2022). These techniques come with multiple variables, including patient demographics, the timing of administration, dosage, route, and drug choice, that play a factor in preventing SIH. Despite the multitude of prophylactic techniques listed, the 6 SPINAL INDUCED HYPOTENSION PROPHYLAXIS American Society of Anesthesiologists (ASA) does not have a set requirement for anesthesia providers to aid in the prevention of hypotension in this patient population (Apfelbaum et al., 2016). Background Maternal death from spinal anesthesia was prevalent as recently as 75 years ago, and early studies aimed to decrease aortocaval compression to enhance maternal hemodynamics and fetal status (Fichter & Nelson, 2019). Initial treatment for hemodynamic instability during spinal anesthesia included fluid pre-loading, maternal positioning, and utilization of compression stockings (Fichter & Nelson, 2019). Today, healthy parturients are still experiencing hypotension up to seventy to eighty percent (70-80%) of the time when undergoing spinal anesthesia when given without any prophylaxis (Noffsinger, 2022). As Fitcher & Nelson (2019) state, finding the solution to spinal anesthesia-induced hypotension has been likened to discovering the Holy Grail of obstetric anesthesia. The ASA lists recommendations to assist the practitioner in decision-making when dealing with SIH from a cesarean section (Apfelbaum et al., 2016). These prophylactic techniques include intravenous (IV) fluid pre-loading or co-loading and the utilization of intravenous ephedrine or phenylephrine for treating hypotensive episodes (Apfelbaum et al., 2016). According to Nixon and Leffert (2022) from UpToDate, the current primary approach for inhibiting SIH includes implementing a low dose phenylephrine intravenous infusion, titrated to maintain systolic blood pressure >100 mmHg or >80% of baseline effect, starting at a dose of 25-50 mcg/minute. Recent studies from all over the world give insight into other prophylactic approaches. However, no single method of prevention implementation solves this frequent 7 SPINAL INDUCED HYPOTENSION PROPHYLAXIS predicament (Fichter & Nelson, 2019). Currently, no research regarding reported techniques utilized to prevent SIH exists in the Midwest, specifically Indiana. Problem Statement Spinal anesthesia is the most common procedure utilized for cesarean sections; however, it can lead to hypotension which can induce maternal nausea, vomiting, dizziness, and compromised uteroplacental perfusion (Xu, Mao, et al., 2019). Discovering a lack of research and reported techniques practiced in preventing SIH during a cesarean section by Certified Registered Nurse Anesthetists (CRNAs) in Indiana led to the following PICOT question to be developed: How do Indiana CRNAs utilize or disuse prophylactic hypotensive techniques before or after spinal administration for healthy parturients delivering via elective cesarean section? A quality improvement project was designed around this question to examine if Indiana CRNAs utilize techniques to reduce hypotension in this patient population prophylactically and if they are different from the current recommended practice. Needs Assessment and Gap Analysis Performing spinal anesthetics, especially in obstetrics, is a common practice for many CRNAs. In the year 2021 in Indiana, 30.4% of live births were delivered via cesarean section (March of Dimes, 2023). After a literature review, no research was found presenting the currently common practice of SIH prophylaxis utilized by Indiana CRNAs. Practitioners should be aware of the clinical recommendations regarding prophylaxis for SIH, as they can make their anesthetic plan based on the assessment of their patient. When discussing prophylactic SIH techniques with practicing Indiana CRNAs, many methods were mentioned based on provider preference, experience, and education. By performing a needs assessment on approaches to reducing SIH in cesarean section patients in Indiana, CRNAs can better understand current 8 SPINAL INDUCED HYPOTENSION PROPHYLAXIS practices, disseminate up-to-date information and recommendations, and provide patients with safe and effective care. Review of the Literature The literature search methodology examined articles regarding prophylactic techniques to reduce SIH in parturients undergoing elective cesarean sections. The review search used the keywords: spinal anesthesia, hypotension, cesarean, and prevention. This review was conducted in November 2022 using the databases: EBSCO Host: Medline Plus with full text and CINAHL Plus with full text. The database searches were performed using the BOOLEAN phrase spinal anesthesia hypotension cesarean AND prevention. The 290 database search results were reduced to exclude duplicate articles, articles not written or translated into English, article publications not within the past seven years, and articles not relating to the female gender resulting in 48 research articles shown in a PRISMA flow chart (Appendix A). The remaining research studies were examined to determine if the studies met the inclusion criteria. The search inclusion criteria included all articles written or translated into English, articles on spinal-induced hypotension preventative measures, and articles regarding spinal anesthesia and maternal hypotension. Synthesis of Literature Review Of the 32 articles, research studies that were not specific to spinal anesthesia, elective cesarean sections, or maternal hypotension were excluded. Research articles were further reduced to include 19 articles consisting of systematic literature reviews, literature reviews, randomized controlled trials, and meta-analyses analyzing different methods of SIH prophylaxis in parturients undergoing elective cesarean sections. In addition, three sources are included to represent current practice guidelines. The literature review matrix, which includes specific information and details of each study, is included in Appendix B. 9 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Practice Guidelines According to Nixon and Leffert (2022), current practice guidelines recommend keeping the maternal blood pressure within 10-20% of the patients baseline blood pressure, or their systolic >100 mmHg, unless the patient has a history of severe hypertension. The primary strategy utilized is a phenylephrine drip titrated to effect between 25-100 mcg/kg/minute or rescue boluses of phenylephrine of 50-100 mcg as needed (Nixon & Leffert, 2022). In the presence of bradycardia, an ephedrine drip can substitute at a rate of 1-5 mg/minute or rescue boluses of 5-10 mg boluses (Nixon and Leffert, 2022). In addition, Nixon and Leffert (2022) include a rapid IV crystalloid bolus co-loading at the time of induction of the spinal anesthetic in their practice guidelines. The American Society of Anesthesiologists practice guidelines supports IV fluid pre-loading or co-loading to prevent spinal-induced hypotension (Apfelbaum et al., 2016). In addition, the ASA recommends either IV phenylephrine or ephedrine depending on the maternal heart rate, although phenylephrine is the drug of choice (Apfelbaum et al., 2016). The Association of Anaesthetist practice guidelines states that prophylactic vasopressors are the preferred treatment of hypotension, alpha-agonists being the most appropriate choice, and phenylephrine being the most supported (Kinsella et al., 2017). In addition to IV colloids or crystalloid co-loading, vasopressors have support from the Association of Anaesthetists (Kinsella et al., 2017). Other practice recommendations to decrease SIH include maternal positioning to achieve left uterine displacement (Apfelbaum et al., 2016; Kinsella et al., 2017). Phenylephrine is the current gold standard for preventing maternal hypotension caused by spinal anesthesia partly due to a noticeable decrease in intraoperative nausea and vomiting and an improved fetal acid-base status compared to other drugs (Apfelbaum et al., 2016; Kinsella et al., 2017; Nixon & Leffert, 2022). 10 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Crystalloid or Colloid Pre-loading or Co-loading In a systematic review, crystalloid co-loading was recommended immediately post-spinal administration, in addition to a phenylephrine infusion (Fichter & Nelson, 2019). In a randomized controlled study, 10 mL/kg of a colloid co-load was found to be more effective in decreasing the norepinephrine infusion by approximately 30% compared to a crystalloid co-load (Jin et al., 2022). According to a systematic review and meta-analysis, colloid pre-loading was found to be superior to crystalloid pre-loading in decreasing SIH (p<0.0001) (Shang et al., 2021). Another meta-analysis showed crystalloid co-loading was superior in preventing hypotension than crystalloid pre-loading (p=0.01) (Ni et al., 2017). Norepinephrine Norepinephrine studies are compared to common vasopressors used to prevent maternal hypotension during spinal anesthesia. One study compared norepinephrine at 4 mcg/kg/minute and ephedrine at 4 mg/minute (Xu, Mao, et al., 2019). Findings suggest norepinephrine showed fewer cases of tachycardia (p=0.002), less heart rate fluctuation, lower heart rate (p=0.04), less fetal distress, and lower systolic blood pressure (p=0.04) when compared to the ephedrine infusion (Xu, Mao, et al., 2019). Another study compared a fixed-rate infusion of norepinephrine and a variable-rate infusion of norepinephrine, but there were technical limitations of an inadequate dose design (Sheng et al., 2022). In a systematic review and meta-analysis comparing norepinephrine and phenylephrine, findings show no significant differences in the treatment of maternal hypotension (p=0.11) (Xu, Shen, et al., 2019). The norepinephrine group was less likely to experience bradycardia and intraoperative nausea and vomiting than the phenylephrine group (p=0.005) 11 SPINAL INDUCED HYPOTENSION PROPHYLAXIS (Xu, Shen, et al., 2019). This specific study showed no differences in Apgar scores and umbilical blood gases (Xu, Shen, et al., 2019). When comparing norepinephrine, there is insufficient evidence to conclude that norepinephrine creates more efficient cardiac output and better blood pressure precision than phenylephrine (Xu, Shen, et al., 2019). More studies are needed before bringing norepinephrine into routine usage (Xu, Shen, et al., 2019). A systematic review comparing norepinephrine to phenylephrine concluded that norepinephrine is similar to phenylephrine, with no apparent signs of maternal or neonatal adverse outcomes (Wang et al., 2018). This review showed a lower incidence of bradycardia and increased cardiac output, but more high-quality studies are needed before it can be appropriately implemented (Wang et al., 2018). Intramuscular phenylephrine dosing was studied compared to a placebo in a randomized controlled trial and showed better neonatal acid-base status (p=0.01) and more stable maternal hemodynamics (p<0.0001) (Xu, Liu, et al., 2019). Fan et al. (2021) completed a double-blinded, randomized controlled trial comparing a norepinephrine infusion to an ephedrine infusion. It was found that norepinephrine resulted in less hypotension (p=0.034), less tachycardia (p<0.001), less nausea and vomiting (p=0.004), and potential neonatal benefits. Ondansetron and Granisetron Effects of prophylactic IV ondansetron given 5 minutes before the spinal anesthetic was performed were studied in a randomized, double-blinded controlled study, and no significant difference was found in the incidence of hypotension between the ondansetron groups and the control group (p=0.767) (Karacaer et al., 2017). The episodes of hypotension and norepinephrine consumption were considerably more significant in the control group compared to the 12 SPINAL INDUCED HYPOTENSION PROPHYLAXIS ondansetron group (p=0.009) (Karacaer et al., 2017). Ondansetron in this study did not prevent SIH, but it did decrease the norepinephrine requirement (Karacaer et al., 2017). Another study compared the effects of prophylactic IV ondansetron, IV granisetron, a control, and the effect on ephedrine requirements (Aksoy et al., 2021). This randomized controlled trial showed that the ephedrine requirement in the control group was higher than both the ondansetron and granisetron group (p=0.033; p<0.001) (Aksoy et al., 2021). The ondansetron and granisetron groups also had lower nausea and vomiting than the control group (p<0.001) (Aksoy et al., 2021). When looking at the incidence of hypotension with prophylactic ondansetron in a randomized controlled superiority trial, it was found that hypotension did not decrease with ondansetron administration (p=0.23) (Oofuvong et al., 2018). In addition, heart rate, blood loss, and ephedrine requirements were similar in the ondansetron and the control groups (Oofuvong et al., 2018). Lower Extremity Elevation or Compression Sequential compression devices (SCDs) were studied in a randomized controlled trial to assess the effects on hemodynamic changes after spinal anesthesia (Javaherforooshzadeh et al., 2020). Ultimately, the diastolic blood pressure was found to be significantly higher in the SCD group (p<0.05), and the SCD group had a lower incidence of nausea (p=0.005), vomiting (p=0.001) and lower mean ephedrine requirement (p=0.001) (Javaherforooshzadeh et al., 2020). Two randomized controlled trials reported the effects of leg elevation immediately after spinal administration (Assen et al., 2020; Hasanin et al., 2017). Both studies showed that patients who were part of the leg elevation group experienced a decreased incidence of hypotension (p=0.043) (p=0.005) (Assen et al., 2020; Hasanin et al., 2017). 13 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Decreased Local Anesthetic Spinal Dosing One systematic review evaluated ten clinical trials that compared the effectiveness of the mean effective dose of intrathecal hyperbaric bupivacaine in 50% of the population (ED50) to the mean effective dose in 95% of the population (ED95) (Tubog et al., 2018). Decreasing the dose of the local anesthetic to ED50 in the spinal was effective in decreasing the incidence of hypotension, but it created more patient discomfort (Tubog et al., 2018). The recommendation of this clinical trial states to utilize a dose that will increase patient satisfaction; however, if a dose of less than ED50 is to be utilized, a combined spinal epidural (CSE) technique would be most beneficial (Tubog et al., 2018). Glycopyrrolate The use of glycopyrrolate was assessed in a meta-analysis of 5 different randomized controlled trials (Patel et al., 2018). There was no difference in decreasing spinal-induced hypotension when using prophylactic glycopyrrolate (p=0.59) (Patel et al., 2018). When assessing the total phenylephrine requirements of the patient, those who received glycopyrrolate had significantly fewer phenylephrine requirements (p=0.006); however, the maximum heart rate (p<0.0001) and incidence of dry mouth (p<0.0001) was significantly increased in the glycopyrrolate group (p<0.0001) (Patel et al., 2018). Discussion There are no practice standards for SIH prophylaxis, but there are practice guidelines. Current practice guidelines list phenylephrine as the drug of choice to prevent SIH (Apfelbaum et al., 2016; Kinsella et al., 2017; Nixon & Leffort, 2022; & Noffsinger, 2022). Fluid blousing as a pre-load or co-load has produced several different results. Fluid blousing studies showed colloid pre-load or co-loading as more effective than crystalloid pre-loading or co-loading (Jin et 14 SPINAL INDUCED HYPOTENSION PROPHYLAXIS al., 2022 & Shang et al., 2021). Crystalloid pre-loading was also more effective than crystalloid co-loading (Ni et al., 2017). Ultimately, fluid boluses are most effective when used with a vasopressor (Apfelbaum et al., 2016). Norepinephrine has been studied in comparison to phenylephrine and ephedrine with positive outcomes; however, more favorable studies are needed to put this method into routine practice (Fan et al., 2021; Sheng et al., 2022; Wang et al., 2018; Xu, Mao, et al., 2019; & Xu, Shen, et al., 2019). While ondansetron and granisetron did not decrease spinal-related hypotension, they did decrease other vasopressor requirements while also decreasing nausea and vomiting (Aksoy et al., 2021 & Karacaer et al., 2017). More research is warranted regarding the use of ondansetron and its use in SIH prophylaxis. The articles found positive evidence of a reduction in blood pressure with both leg elevation and SCDs, although rescue medications were still needed (Javaherforooshzadeh et al., 2020; Assen et al., 2020; & Hasanin et al., 2017). When reducing the dosage of spinal anesthetics, evidence showed that redosing was likely to occur because of the mothers discomfort (Tubog et al., 2018). Glycopyrrolate was not found to have a positive effect in decreasing SIH, although it did decrease vasopressor requirements (Patel et al., 2018). Ultimately, there is no practice standard to reliably prevent SIH for women undergoing elective cesarean sections. More research is necessary to find the best practice. Theoretical Framework The Johns Hopkins Nursing Evidence-Based Practice for Nurses and Healthcare Professionals (JHNEBP) model is a framework utilized individually or for groups and guides the research project (John Hopkins Medicine, 2022). (See Appendix C). This model ensures that the best evidence-based practices will be appropriately implemented in patient care (Upstate Medical University Health Sciences Library, 2022). The PET process in the JHNEBP model identifies the 15 SPINAL INDUCED HYPOTENSION PROPHYLAXIS practice question, evidence to answer the question, and translation into practice (Upstate Medical University Health Sciences Library, 2022). In this study, a survey determines the utilization of SIH prophylactic techniques by Indiana CRNAs. An analysis is conducted, keeping in mind the most current recommendations centered around evidence-based practice, and the data has been disseminated to a professional organization. Project Aims and Objectives This project aims to assess currently practicing CRNAs in Indiana and their adherence to the recommended practice regarding SIH prophylaxis. Hypotension caused by spinal anesthesia in obstetric patients undergoing a cesarean section is common. This project assesses SIH prophylaxis techniques utilized by Indiana CRNAs compared to evidence-based practice recommendations through a survey. An anonymous survey has been distributed to Indiana CRNAs and asked qualitative questions regarding their techniques, if any, used for hypotension prevention during spinal anesthesia in patients undergoing a scheduled cesarean section. The expected outcome is that most Indiana CRNAs report using the recommended practice guidelines based on up-to-date and evidence-based practice. Dissemination with a professional organization has been established to assess the need for potential further education. Project Design and Methods An email with an anonymous link to a Qualtrics self-assessment survey was administered to the five hundred and sixty-five (565) Indiana Association of Nurse Anesthetists (INANA) group members. Mary Nguyen Reynolds, the 2022 president of the INANA and this projects Team Member, utilized her email contact list of INANA members to send out this survey. Actively practicing CRNAs in the State of Indiana were invited to participate in this survey composed by this DNP projects DNP student. 16 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Project Site and Population The DNP project takes place in the state of Indiana. Indiana is a midwestern state with various types of hospitals and practicing CRNAs. The population in this study includes any practicing CRNA in Indiana who works with laboring women and provides spinal anesthesia for cesarean sections. Exclusion criteria includes CRNAs who are not currently practicing or do not practice obstetric anesthesia. Measurement Instruments Measurement of the outcomes of this DNP project included an online self-assessment survey designed using Qualtrics. The survey that was distributed included seven quantitative questions evaluating methods these anesthesia providers utilize to prevent SIH in parturients undergoing elective cesarean sections (See Appendix D). Data Collection Procedures Data collection was completed with the online survey software program of Qualtrics. The email sent to the potential participants of the study granted access to an anonymous link for an online survey administered through Qualtrics. An information sheet with implied consent was presented in the email (See Appendix E). It stated the title of the project, an explanation of the survey, the risks associated with the project, and an invitation to participate. There was no risk to the participants; participation was entirely anonymous and voluntary. No identifying information was collected. The participants had access to the survey for two weeks, during which a reminder email was distributed after one week. Data collection was completed and stored through Qualtrics, and the survey closed after two weeks. The DNP student is the only person with access to the data and utilized a password-protected Marian University Qualtrics account. In addition, a password-protected laptop was utilized to access collected data. There are five 17 SPINAL INDUCED HYPOTENSION PROPHYLAXIS hundred and sixty-five (565) members in the INANA. The response rate goal was accomplished with 75 responses recorded. All data was collected, summarized, analyzed, and is presented under Results. Ethical Considerations Ethical considerations for the DNP project included keeping all responses anonymous without any identifiable information and obtaining implied consent from participants. The implied consent information sheet explained the reason behind the study and what was to be done with the information collected. All information collected from participants was to be disclosed with permission from each participant. There were no ethical concerns or risks for this project. The DNP student will delete the raw data collected for this project after three years. Results A total of 565 Indiana CRNAs were contacted to participate in this DNP project. The population sample size consisted of 75 Indiana CRNAs (n=75) who answered all survey questions, demonstrating a 13.27% response rate. 75 CRNAs completed the survey within a twoweek period. Years of experience varied from 0-9 years of practice (48%) to 10+ years of practice (52%). Most respondents also consisted of CRNAs practicing in Northern Indiana (47.5%) versus Central Indiana (30%) or Southern Indiana (22.5%). Many of these Indiana CRNAs reportedly worked in a local community hospital (46.67%). Please see Table 1 to view the demographics of all survey respondents. Table 1 Participant Demographics Survey Questions Characteristics Frequency Percentage CRNA experience (years) < 5 years 19 25.33 5-9 years 17 22.67 18 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Location in Indiana Healthcare facility 10-14 years 13 17.33 15-20 years 5 6.67 > 20 years 21 28 Northern Indiana 38 47.5 Central Indiana 24 30 Southern Indiana 18 22.5 Large hospital network 25 33.33 Local community hospital 35 46.67 Critical access hospital 13 17.33 Obstetric clinic 0 0 Other: Please specify 2 2.67 Note: The two open-ended responses for the healthcare facility included All and ASC. Participant SIH Background and Prophylaxis The survey administered to Indiana CRNAs aided in determining the participants background with SIH. A majority of responses indicated the healthcare facility in which the CRNA worked, did not have a protocol for treating SIH (78.67%). Additionally, 84% of Indiana CRNAs reported the use of prophylactic techniques. The most reported uses of prophylactic techniques by Indiana CRNAs included intravenous crystalloid infusion (23.99%), intravenous zofran (17.58%), ephedrine bolus (16.22%), phenylephrine bolus (15.88%), and decreased height-based dosing of spinal anesthetic (12.50%). Please see Table 2 to view all survey results. Table 2 Participant Background with Spinal Induced Hypotension (SIH) Prophylaxis Survey Questions Characteristics Frequency Percentage 19 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Healthcare facility SIH Yes protocol No CRNA use of prophylactic techniques Prophylactic or rescue techniques utilized by CRNAs for SIH 6 8 59 78.67 Unknown 10 13.33 Yes 49 65.33 No 4 5.33 Sometimes 8 10.67 Always 14 18.67 Intravenous crystalloid infusion 71 23.99 Intravenous colloid infusion 2 0.68 Combined intravenous crystalloid and colloid infusion 1 0.34 Phenylephrine bolus 47 15.88 Phenylephrine infusion 11 3.72 Ephedrine bolus 48 16.22 Ephedrine infusion 2 0.68 Norepinephrine infusion 0 0.00 Intravenous ondansetron 52 17.58 Intravenous granisetron 2 0.68 Sequential Compression Devices (SCDs) 16 5.41 Patient leg elevation 0 0.00 Decreased height-based dosing of spinal anesthetic 37 12.50 Intravenous glycopyrrolate 2 0.68 None of the above 0 0.00 20 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Other: Please specify 5 1.69 Note: The select all that apply question regarding prophylactic and rescue methods to treat SIH warranted 296 total responses. Percentages are calculated by using a total of 296 responses. Qualitative Results Question six and question seven consisted of open-ended questions regarding other prophylactic methods not mentioned in the previous question. Many responses included Zofran and Ephedrine. Please see Table 3 for a full list of added responses from participants. Table 3 Participant Qualitative Results Survey Questions Participant Response IV Zofran Ephedrine skin wheel on SAB IM Ephedrine Occasionally will give Ephedrine 10mg IVP and then give the rest of that vial (40mg) IM in the thigh right after spinal/before drape to help prevent a drop. 5. Zofran Other techniques utilized 1. IM Ephedrine (Question 7) 2. Intravenous Zofran 3. No 4. No 5. IM Ephedrine 6. 25 mg Ephedrine IM after spinal is placed and patient is placed supine. 7. IM ephedrine if Ive not given sq 8. No 9. No 10. No 11. Zofran approximately 5 minutes before spinal 12. No 13. I treat SIH based on HR and patient symptoms, which can occur before the BP reads. I will bolus phenylephrine if the heart rate increases above 100 bpm or, if the patient reports nausea, Ill bolus phenylephrine or ephedrine based on the HR. 14. Uterine wedge 15. See other 16. N/A Note: Answers are displayed as they were submitted. Other methods utilized to decrease SIH not listed (Question 6) 1. 2. 3. 4. 21 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Graphed Results An organized graph of the survey results of prophylactic and rescue interventions for SIH utilized by Indiana CRNAs are included in Figure 1, please see below. Figure 1 How do Indiana CRNAs utilize or disuse prophylactic hypotensive techniques before or after spinal administration for healthy parturients delivering via elective cesarean section? Discussion This descriptive study surveyed current practices of Indiana CRNAs and their approach to preventing and treating hypotension in healthy parturients undergoing a cesarean section. Overall, CRNA responses were gathered from individuals working in Northern Indiana (47.5%) and local community hospitals (47.5%). The number of CRNAs who reported their facility does not have a SIH protocol was evident with a 78.67% response rate. In addition, 84% of Indiana CRNAs reported their use of prophylactic techniques for SIH. Current practice guidelines 22 SPINAL INDUCED HYPOTENSION PROPHYLAXIS recommend fluid loading and phenylephrine as the drug of choice to prevent SIH (Apfelbaum et al., 2016; Kinsella et al., 2017; Nixon & Leffort, 2022; & Noffsinger, 2022). When compared to current practice guidelines, Indiana CRNAs are utilizing the current practice recommendations of intravenous crystalloid fluid loading (23.99%), ephedrine boluses (16.22%), and phenylephrine boluses (15.88%). While current practice guidelines suggest phenylephrine drips are useful in preventing SIH, only 3.72% of Indiana CRNAs reported utilizing this prophylactic measure. Significant methods utilized by Indiana CRNAs that are not listed as current practice guidelines included administration of Zofran (17.58%) and decreased height-based dosing of spinal anesthetic (12.5%). Limitations The limitations in this study include utilizing only generic names for the medications listed in the survey. Several responses in the open-ended answers from the survey listed Zofran as a medication utilized in their preventative measures in addressing SIH. Listing both the generic and trade names in the survey would have cleared up any confusion for the sample population. Conclusion Pregnant women undergoing elective cesarean sections experience hypotension up to 7080% when undergoing spinal anesthesia without any prophylactic measures in place (Noffsinger, 2022). This descriptive study was able to analyze prophylactic techniques for SIH utilized by Indiana CRNAs through an online survey and compare the results to the current recommended practice guidelines. A majority of responses from Indiana CRNAs included the current recommended practice guidelines with the exception of phenylephrine infusions. Practice guidelines should continue to be evaluated and distributed to anesthesia providers to ensure best 23 SPINAL INDUCED HYPOTENSION PROPHYLAXIS practice for patient populations. Future studies implementing phenylephrine drips as prophylaxis to SIH can give further insight to all Indiana CRNAs practicing in obstetrics. 24 SPINAL INDUCED HYPOTENSION PROPHYLAXIS References Aksoy, M., Dostbil, A., Aksoy, A.N., Ince, I., Bedir, Z., & Ozmen, O. (2021). Granisetron or ondansetron to prevent hypotension after spinal anesthesia for elective cesarean delivery: A randomized placebo-controlled trial. Journal of Clinical Anesthesia 75(2021). http://doi.org/10.1016/j.jclinane.2021.110469 Apfelbaum, J., Hawkins, J.L., Agarkar, M., Bucklin, B.A., Connis, R.T., Gambling, D.R., Mhyre, J., Nickinovich, D.G., Sherman, H., Tsen, LC, & Yaghmour, T.A. (2016). Practice guidelines for obstetric anesthesia: An updated report by the American Society of Anesthesiologists task force on obstetric anesthesia and the society for obstetric anesthesia and perinatology. Anesthesiology 124(2). http://doi.org/10.1097/ALN.0000000000000935 Assen, S., Jemal, B., & Tesfaye, A. (2020). Effectiveness of leg elevation to prevent spinal anesthesia-induced hypotension during cesarean delivery in the resource-limited area: Open randomized controlled trial. Anesthesiology Research and Practice 2020. http://doi.org/10.1155/2020/5014916 Fan, Q., Wang, Y., Fu, J., Dong, H., Yang, M., Liu, D., Jiang, X., Wu, Z., Xiong, L, & Lu, Z. (2021). Comparison of two vasopressor protocols for preventing hypotension post-spinal anesthesia during cesarean section: A randomized controlled trial. Chinese Medical Journal 134(7). http://doi.org/10.1097/CM9.0000000000001404 Fichter, J.L., & Nelson, K.E. (2019). Optimal management of hypotension during cesarean delivery under spinal anesthesia. Advances in Anesthesia, 37, 207-228. http://doi.org/10.1016/j.aan.2019.08.008 25 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Hasanin, A., Aiyad, A., Elsakka, A., Kemel, A., Fouad, R., Osman, M., Mokhtar, A., Refaat, S., & Hassabelnaby, Y. (2017). Leg elevation decreases the incidence of post-spinal hypotension in cesarean section: A randomized controlled trial. BMC Anesthesiology 17(60). http://doi.org/10.1186/s12871-017-0349-8 Javaherforooshzadeh, F., Pipelzadeh, M., Akhondzadeh, R., Adarvishi, S., & Alghozat, M. (2020). Effect of sequential compression device on hemodynamic changes after spinal anesthesia for cesarean section: a randomized controlled trial. Anesthesia Pain Medicine 10(5). http://doi.org/10.5812/aapm.104705 Jin, W., Mao, J., Liu, J., Liang, G., Jiang, C., & Sheng, Z. (2022). Comparative dose-response study on the infusion of norepinephrine combined with crystalloid co-load versus colloid co-load for preventing hypotension during spinal anesthesia for cesarean delivery. Drug Design, Development and Therapy 16(2617-2626). https://doi.org/10.2147/DDDT.S378453 Johns Hopkins Medicine. (2022). Institute for Johns Hopkins nursing: Models and tools. Found on 11/3/2022 @ https://www.hopkinsmedicine.org/institute_nursing/modelstools.html#ebp Karacaer, F., Biricik, E., Unal, I., Buyukkurt, S., & Unlugenc, H. (2017). Does prophylactic ondansetron reduce norepinephrine consumption in patients undergoing cesarean section with spinal anesthesia? Journal of Anesthesia 32(90-97). http://doi.org./10.1007/s00540017-2436-x Kinsella, S.M., Carvalho, B., Dyer, R.A., Fernando, R., McDonnell, N., Mercier, F.J., Palanisamy, A., Sia, A.T.H., Van de Velde, M., & Vercueil, A. (2017). International consensus statement on the management of hypotension with vasopressors during 26 SPINAL INDUCED HYPOTENSION PROPHYLAXIS cesarean section under spinal anesthesia. Association of Anaesthetists 73(1). https://doi.org/10.1111/anae.14080 March of Dimes. (2023). Data for Indiana. https://www.marchofdimes.org/peristats/data?reg=99&top=8&stop=87&lev=1&slev=4& obj=18&sreg=18 Ni, H., Liu, H., Zhang, J., Peng, K., & Ji, F. (2017). Crystalloid co-load reduced the incidence of hypotension in spinal anesthesia for cesarean delivery, when compared to crystalloid preload: A meta-analysis. BioMed Research International 2017. http://doi.org/10.1155/2017/3462529 Noffsinger, S.R. (2022). Evidence-based prevention strategies for the management of spinal anesthesia-induced hypotension in healthy parturients undergoing elective cesarean delivery. AANA Journal, 90(4), 311-316. No DOI Nixon, H., & Leffert, L. (2022). Anesthesia for cesarean delivery. Up To Date. Found at https://www-uptodate-com.forward.marian.edu/contents/anesthesia-for-cesareandelivery?sectionName=Hemodynamic%20management&search=Hypotension%20spinal %20anesthesia%20preventative&topicRef=105456&anchor=H840431840&source=see_l ink#H285928114 Oofuvong, M., Kunapaisal, T., Karnjanawanichkul, O., Dilokrattanaphijit, N., & Leeratiwong, J. (2018). Minimal effect weight-based dosing of ondansetron to reduce hypotension in cesarean section under spinal anesthesia: A randomized controlled superiority trial. BMC Anesthesiology 8(105). http://doi.org/10.1186/s12871-018-0568-7 Patel, S., Habib, A., Phillips, S., Carvalho, B., & Sultan, P. (2018). The effect of glycopyrrolate on the incidence of hypotension and vasopressor requirement during spinal anesthesia for 27 SPINAL INDUCED HYPOTENSION PROPHYLAXIS cesarean delivery: A meta-analysis. International Anesthesia Research Society 126(2). http://doi.org/10.1213/ANE.000000000000227 Shang, Y., Li, H., Ma, J., Tan, L., Li, S., Li, P., Sheng, B., & Wang, R. (2021). Colloid preloading versus crystalloid pre-loading to prevent hypotension after spinal anesthesia for cesarean delivery: A protocol for systemic review and meta-analysis. Medicine 100(7). http://doi.org/10.1097/MD.0000000000024607 Sheng, Z., Shen, Y., Pan, Z., Zhu, M., Sun, H., Liu, J., & Qian, X.(2022). Comparative study on the manually-controlled variable rate versus fixed-rate infusion of norepinephrine for preventing hypotension during spinal anesthesia for cesarean delivery. Journal of Clinical Anesthesia 82(2022). http://doi.org/10.1016/j.jclinane.2022.110944 Tubog, T.D., Ramsey, V.L., Filler, L., & Bramble, R.S. (2018). Minimum effect dose (ED50 and ED95) of intrathecal hyperbaric bupivacaine for cesarean delivery: A systematic review. AANA Journal 86(5). No DOI Upstate Medical University Health Sciences Library. (2022). Johns Hopkins nursing evidencebased practice: A companion guide for Johns Hopkins nursing evidence-based practice at upstate. Found on 11/3/2022 @ https://guides.upstate.edu/c.php?g=1023176&p=7411252 Wang, X., Shen, X., Liu, S., Yang, J., & Xu, S. (2018). The efficacy and safety of norepinephrine and its feasibility as a replacement for phenylephrine to manage maternal hypotension during elective cesarean delivery under spinal anesthesia. BioMed Research International. https://doi.org/10.1155/2018/1869189 Xu, C., Liu, S., Qian, D., Liu, A., Liu, C., Chen, Y., & Qi, D. (2019). Preventative intramuscular phenylephrine in elective cesarean section under spinal anesthesia: A randomized 28 SPINAL INDUCED HYPOTENSION PROPHYLAXIS controlled trial. International Journal of Surgery 62(5-11). http://doi.org/10.1016/j.iju.2018.12.014 Xu, S., Mao, M., Zhang, S., Qian, R., Shen, X., Shen, J., & Wang, X. (2019). A randomized double-blind study comparing prophylactic norepinephrine and ephedrine infusion for preventing maternal spinal hypotension during elective cesarean section under spinal anesthesia. A consort compliant article. Medicine 2019, 98(51). http://dx.doi.org/10.1097/MD.0000000000018311 Xu, S., Shen, X., Liu, S., Yang, J., & Wang, X. (2019). Efficacy and safety of norepinephrine versus phenylephrine for the management of maternal hypotension during cesarean delivery with spinal anesthesia. Medicine 98(5). http://doi.org/10.1097/MD.000000000001433 29 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Appendix A PRISMA 2020 Flow Diagram Screening Identification Identification of studies via databases Records identified from*: Ebsco Host- Medline Plus with full text and CINAHL Plus with full text Databases (n = 290) Records removed before screening: Records removed (n = 242) Records screened (n = 48) Records excluded (n =14) Reports sought for retrieval (n = 32) Reports not retrieved (n = 0) Included Reports assessed for eligibility (n = 32) Studies included in review (n = 19) Reports excluded: Reason 1 (n = 31) Results not pertaining to spinal anesthesia Reason 2 (n = 30) Results did not pertain to elective cesarean section Reason 3 (n = 11) Results did not pertain to maternal hypotension. Running head: SPINAL INDUCED HYPOTENSION PROPHYLAXIS 30 Appendix B Citation Aksoy et al. 2021 Apfelbaum , et al. Research Design Population / Sample size n=x Randomized n=125 Controlled parturients trial undergoing elective cesarean sections and spinal anesthesia Major Variables Instruments / Data collection Results Age, height, weight, ASA status, operation time, mean blood pressure, baseline heart rate, baseline SpO2 values, time to T6 level, time of regression to T10 level, ephedrine requirement, atropine requirement, intraoperative nausea and vomiting, shivering Intraoperative hemodynamic changes recorded every 2 minutes for 20 minutes, then every 5 minutes until the end of the operation; visual analogue scale (VAS) Practice Guidelines N/A N/A N/A Ondansetron and granisetron resulted in lower ephedrine requirements p=0.001; ephedrine requirement in group III was higher than in group I p=0.033 and group II p<0.001; ephedrine requirement in group II lower than group I, but not statistically significant p=0.055; patients with nausea and vomiting were lower in groups I and II compared to group III p<0.001 Recommendations: IV fluid pre-loading or coloading; IV ephedrine or phenylephrine n=52 parturients scheduled for elective cesarean sections with spinal anesthesia Age, height, weight, BMI, baseline SBP and DBP, baseline HR, number of previous cesarean sections, time of spinal to delivery, duration of Comparison of SBP and DBP, bradycardia, and phenylephrine consumption between the two groups. 2016 Assen et al. Open randomized 2020 controlled trial Hypotension was decreased in the leg elevation group (p=0.043); Risk of developing post spinal hypotension in the leg elevation group 31 SPINAL INDUCED HYPOTENSION PROPHYLAXIS surgery, intraoperative fluid, weight of baby, nausea and vomiting, bradycardia, and blood loss Fan et al. 2021 Doubleblinded randomized controlled trial n=177 parturients scheduled for elective cesarean section with spinal anesthesia Age, BMI, height, weight, gravidity, type of parturient, gestation, upper blockade, duration from SA to umbilical cord clamp, uterine tonic, duration of surgery, volume of LR, EBL Baseline HR and SBP measured; assessment of dermatomal level of spinal; SBP and HR recorded every 2 minutes after spinal for 30 minutes; umbilical arterial blood gas; comparison of intervention and control group Fichter & Nelson Systematic Review n=25 Review comparing different techniques in reducing hypotension during spinal anesthesia in Definitions of hypotension, differing techniques, differing dosages Incidence of hypotension regarding prevention technique 2019 compared to control group was (p=0.47); Severe hypotension was significantly decreased in leg elevation group (p=0.02) Decreased hypotension with norepinephrine than ephedrine (p=0.034); Tachycardia was lower in norepinephrine group than the ephedrine group (p<0.001); Fewer patients experienced nausea and vomiting in the norepinephrine group than in the ephedrine group (p=0.004); norepinephrine group had neonatal cerebral regional saturations (p=0.008) Recommendations: Prespinal LE compression, 5-HT3 Antagonist; Immediately postspinal: Crystalloid coload, phenylephrine infusion, left lateral tilt; 32 SPINAL INDUCED HYPOTENSION PROPHYLAXIS pregnant women undergoing elective cesarean section Hasanin et al. 2017 Randomized n=150 parturients controlled scheduled for trial cesarean section with spinal anesthesia Javaherforo Randomized n=76 parturients oshzadeh et controlled undergoing al. trial elective cesarean section with spinal 2020 anesthesia Jin et al. 2022 Randomized n=200 controlled parturients study undergoing Age, weight, time from spinal to delivery, total infused volume, urine output, blood loss, incidence of hypotension, ephedrine consumption, nausea and vomiting, bradycardia, and hypotensive episodes Age, height, weight, gestational age, maximum sensory block, skin incision to delivery time, spinal anesthesia to delivery time, duration of surgery Arterial blood pressure, heart rate, intraoperative ephedrine consumption, incidence of post spinal hypotension, and incidence of nausea and vomiting Age, height, weight, gestational age, baseline SBP, baseline Baseline systolic blood pressure, NIBP measurement every Comparison of maternal hemodynamic changes within 75 minutes after spinal anesthesia, nausea, vomiting and neonatal Apgar score at 1 and 5 minutes between the groups. Intraoperatively: Crystalloid maintenance, continue phenylephrine infusion, return to supine position. Groupe LE showed lower incidence of post spinal hypotension (p=0.005); LE group showed less ephedrine consumption (p=0.001) Diastolic blood pressure was significantly higher in the SCD group than in the control group (p<0.05); SCD group had lower incidences of nausea (p=0.005) and vomiting (p=0.001); SCD group had lower mean ephedrine dosages per patient (p=0.001) ED50 and ED90 norepinephrine infusion 33 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Karacaer et al. 2017 Kinsella et al. 2017 elective cesarean section and spinal anesthesia HR, upper sensory level, spinal anesthesia to delivery interval, total norepinephrine consumption before delivery, intravenous fluid volume given Prospective, randomized, doubleblinded, controlled study n=108 parturients undergoing elective cesarean sections and spinal anesthesia Age, weight, height, BMI, parity, indications for cesarean, previous cesarean history, acute fetal distress, duration of surgery, Apgar score, umbilical blood gas Practice Guidelines N/A N/A minute after intrathecal injection to delivery, then every 3 minutes until surgery complete, and dermatome level of spinal combined with crystalloid co-load 10mL/kg colloid coload decreased the dose of prophylactic norepinephrine infusion by ~30% compared to crystalloid co-load Incidence of No significant hypotension, cumulative difference found in the episodes of hypotension, incidence of total norepinephrine hypotension between consumption, adverse the groups (p=0.767); effects Cumulative episodes of hypotension and norepinephrine consumption were significantly greater in Group S than Group O (p=0.009) N/A Recommendations: vasopressors for hypotension; alphaagonists most appropriate phenylephrine being most supported; left lateral uterine displacement and IV colloid or crystalloid co-loading used in addition to vasopressors 34 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Ni et al. Metaanalysis 2017 Nixon & Leffert Practice Guidelines n=10 studies determining whether crystalloid infusion co-load or crystalloid preload would be better for hypotension prophylaxis in spinal anesthesia for women undergoing cesarean sections N/A Difference in parturients and medical history Intraoperative incidence of hypotension, need for vasopressors, hemodynamic variables, neonatal outcomes, and incidence of maternal nausea and vomiting Hypotension was significantly higher in the pre-load group compared to the coload group (p=0.01); Intraoperative vasopressors were higher in pre-load group (p=0.02); Nausea and vomiting were higher in the pre-load group (p<0.0001) N/A N/A n=25 25 articles comparing prophylactic spinal-induced hypotension techniques in pregnant women undergoing Definition of hypotension, healthy parturients, differing techniques, dosage, current evidence, current common practice Incidence of hypotension regarding prevention technique; electronic literature search using multiple databases Recommendations: Aim to keep blood pressure within 10-20% of baseline; phenylephrine drip or rescue boluses; ephedrine drip or rescue boluses; rapid IV crystalloid bolus 15 mL/kg rapid crystalloid pre-load or co-load; a colloid preload of 250-300 mL; prophylactic IV phenylephrine infusion; rescue boluses of ephedrine or phenylephrine PRN; IV ondansetron; small 2022 Noffsinger 2022 Systematic Review 35 SPINAL INDUCED HYPOTENSION PROPHYLAXIS elective cesarean sections Oofuvong et al. 2018 Patel et al. 2018 Randomized controlled superiority trial n=215 parturients undergoing elective cesarean sections and spinal anesthesia Age, weight, height, BMI, type of operation, site of spinal, number of blocks, anesthesia level, analgesia level, premedication with metoclopramide, and premedication with ranitidine Metaanalysis n=5 trials that assessed the effects of glycopyrrolate on spinal induced hypotension during cesarean section Differences in parturients and medical history Comparison of hypotension mean arterial pressure, heart rate, vasopressor requirements, blood loss, and maternal and fetal complications between groups. Changes in BP and HR were compared using the generalized estimating equations method. Intraoperative hypotension, vasopressor requirement, heart rate, nausea and vomiting, dry mouth, and Apgar scores, risk ratios, and mean differences. doses of local anesthetic; Lower limb compression devices Incidence of hypotension (p=0.23); Hypotension before delivery (p=0.02); Heart rate, ephedrine requirements, and blood loss were similar among all groups; Metoclopramide requirement was lower in group O2 compared to group NS (p=0.01) No difference between prophylactic group and glycopyrrolate group in decreasing spinalinduced hypotension (p=0.59); Total phenylephrine dose required was significantly decreased with glycopyrrolate (p=0.006); Max heart rate was significantly increased in glycopyrrolate group (p<0.0001); Glycopyrrolate group had a significant 36 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Shang et al. Systemic review and 2021 metaanalysis n=33 Difference in trials comparing parturients and colloid pre-loading medical history with crystalloid pre-loading in pregnant women undergoing cesarean delivery and spinal anesthesia Sheng et al. Prospective randomized, 2022 controlled study n=161 parturients scheduled for an elective cesarean section with spinal anesthesia Difference in parturients and medical history Tubog et al. n=10 clinical trials evaluating Source/country, ASA class, dose-finding method, dosing Systematic Review increase in dry mouth (p<0.0001) Hypotension, total Less hypotension in the ephedrine dose, colloid group compared phenylephrine to the crystalloid group requirement, incidence (p<0.0001); ephedrine of nausea and vomiting, requirement was lower Apgar score, and in colloid group umbilical pH (p=0.009); Total phenylephrine requirement was lower in colloid group (p=0.0002); nausea and vomiting were decreased in colloid group (p=0.02) Incidence of maternal Incident of maternal hypotension, hypotension hemodynamic significantly lower in performance, physician Group V than in Group interventions, reactive F (p<0.001); Group V hypertension, needed more physician bradycardia, nausea, intervention compared vomiting, with group F norepinephrine (p<0.001). accumulative dose Overall, technical before delivery, neonatal limitations of outcomes inadequate dose design, so neither group was optimal. Spinal induced Decreasing the dose of hypotension, local anesthetic and intraoperative pain decreases the incidence 37 SPINAL INDUCED HYPOTENSION PROPHYLAXIS 2018 Wang et al. 2018 Xu, Liu et al. Systematic literature review hyperbaric bupivacaine and the mean effective dose in 50% (ED50) and 95% (ED95) of patients intervals, intrathecal solution, lumbar level, position, assessment for sensory level, minimum effective dose, other outcomes, definition of spinal induced hypotension, prophylaxis, treatment, n=9 review of reports reviewing hypotension with norepinephrine and phenylephrine in spinal anesthesia for elective cesarean sections Frequency of postComparison of variables spinal hypotension, between groups in bradycardia, studies presented hypertension, rescue boluses, success of NE to maintain BP, dose response curve, cardiac output Randomized n=99 parturients Controlled undergoing trial elective cesarean Age, gestational week, height, weight, BMI, ASA grade, number of supplementation, hyperbaric bupivacaine dose, intrathecal opioid dose Noninvasive blood pressure monitoring, heart rate; baseline of spinal induced hypotension and maternal and fetal consequence; Dose at ED50 decreased spinal induced hypotension, but it created more patient discomfort due to inadequate anesthesia; Doses at ED95 provided adequate anesthesia but increased risk of maternal hypotension; CSE recommended if planning to underdose local in spinal anesthesia Norepinephrine is similar to phenylephrine; Norepinephrine had lower incidence of bradycardia and greater cardiac output; Norepinephrine seems to be a good alternative, but more favorable, high-quality studies needed Significant differences in umbilical artery pH: p<0.05; 38 SPINAL INDUCED HYPOTENSION PROPHYLAXIS 2019 Xu, Mao et al. 2019 section and spinal anesthesia Double Blinded, Randomized Controlled trial n=97 women undergoing an elective cesarean section and spinal anesthesia previous deliveries, baseline SBP, baseline DBP, baseline HR, neonatal weight, anesthesia time, time from end of anesthesia to delivery, intraoperative fluid volume, intraoperative blood loss, intraoperative urine volume Age, height, weight, gestational age in weeks, repeated cesarean delivery, block dermatome at 5 mins and 15 minutes, fasting time, volume of co-hydration, estimated blood loss, time of induction to delivery, time of uterine incision to delivery, drug consumption: norepinephrine and ephedrine; volume of vasopressor, birth weight blood pressure defined as SBP, DBP, and HR average of three continuous measurement with variations within 10%; hypotension defined as decrease in SBP >20% of baseline SBP; POC arterial and venous blood gas analyzer; APGAR score; admission to NICU Tachycardia, bradycardia, hypertension, hypotension, severe hypotension, hypotensive episodes, number or rescue topups, hemodynamic performance error including median performance error (MDPE), median absolute performance error (MDAPE), neonatal APGAR scores, and umbilical arterial blood gas Fetal acidosis: p=0.01; maternal intraoperative hypotension: p<0.0001; preventative intramuscular phenylephrine provides a better neonatal acidbase status and more stable maternal hemodynamics Group N had fewer cases of tachycardia (p=0.002); Group N had lower standardized HR (p=0.04); Group N had a lower MDPE for HR (p=0.003); Group N highest HR than group E (both p<0.05); standardized SBP in group N was lower than in group E (p=0.04). 4mcg/kg/min of norepinephrine had fewer cases of tachycardia, less fluctuation and lower HR than ephedrine drip. 39 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Xu, Shen et Systemic al. review and meta2019 analysis n=294 Systemic literature search leading to review of 4 reports and 294 parturients Maternal outcomes: hypotension, hypertension, IONV, maternal CO, BP control precision; Neonatal outcomes: Apgar scoring, umbilical cord blood gas; heterogeneity analysis and publication bias Comparison of variables between groups in studies presented No difference in norepinephrine and phenylephrine for treatment of maternal hypotension (p=0.11); No difference in the occurrence of hypertension (p=0.45); Norepinephrine group less likely to experience bradycardia and IONV than phenylephrine group (p=0.005) 40 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Appendix C Adapted from Dang, D., Dearholt, S., Bissett, K., Ascenzi, J., & Whalen, M. (2022). Johns Hopkins evidence-based practice for nurses and healthcare professionals: model and guidelines. 4th ed. 41 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Appendix D 1. How long have you been a practicing CRNA? a. <5 years b. 5-9 years c. 10-14 years d. 15-20 years e. >20 years 2. Where do you practice as a CRNA in Indiana? Select all that apply. **Northern Indiana is everything North of Noblesville, IN. **Central Indiana is everything between Noblesville, IN and Columbus, IN. **Southern Indiana is everything South of Columbus, IN. a. Northern Indiana b. Central Indiana c. Southern Indiana 3. How would you describe the Indiana healthcare facility in which you work? a. Large hospital network b. Local community hospital c. Critical access hospital d. Obstetric clinic e. Other: Please specify ________________ 4. Does your healthcare facility have a protocol for spinal induced hypotension (SIH) prophylaxis in obstetric anesthesia? a. Yes b. No c. Unknown 5. Do you use prophylactic technique(s) to decrease the incidence of SIH in obstetric anesthesia? a. Yes b. No c. Sometimes d. Always 6. Do you use any of the prophylactic or rescue techniques to reduce SIH in obstetric anesthesia listed below? Select all that apply. a. Intravenous crystalloid infusion b. Intravenous colloid infusion c. Combined intravenous crystalloid and colloid infusion d. Phenylephrine bolus e. Phenylephrine infusion f. Ephedrine bolus g. Ephedrine infusion 42 SPINAL INDUCED HYPOTENSION PROPHYLAXIS h. i. j. k. l. m. n. o. p. Norepinephrine infusion Intravenous ondansetron Intravenous granisetron Sequential Compression Devices (SCDs) Patient leg elevation Decreased height-based dosing of spinal anesthetic Intravenous glycopyrrolate None of the above Other: Please specify ____________________ 7. Do you use another prophylactic technique to reduce SIH in obstetric anesthesia not listed above? If yes, please briefly explain here. _____________________________________________________________ 43 SPINAL INDUCED HYPOTENSION PROPHYLAXIS Appendix E Spinal Induced Hypotension Prophylaxis: Indiana CRNA Techniques This descriptive study is presented by a Marian University Doctor of Nursing Practice student in the Nurse Anesthesia track. This research project aims to evaluate Indiana CRNAs and the use of prophylactic treatment spinal induced hypotension (SIH) for healthy pregnant woman undergoing elective cesarean sections. You are invited to participate in this research project because you currently practice anesthesia as a CRNA in Indiana. If you do not practice obstetric anesthesia, you should not sign up for this study. Participation in this research survey is voluntary, and you may withdraw participation at any time without penalty. This 7-question survey will take approximately 5 minutes to complete. Questions will include general demographics, prevention, and treatment options utilized to prevent hypotension after spinal administration in obstetrics. This survey is anonymous, and no identifying information will be collected. All information will be kept confidential, and data will be stored securely in a password-protected electronic format. The results of this study will only be used for scholarly purposes and may be shared with Indiana Association of Nurse Anesthetists (INANA) members. This research project has been reviewed and approved by the Marian University Institutional Review Board (IRB). If you have any questions about this survey, please contact the Marian IRB at IRB@marian.edu or Kristen Thomas at kthomas759@marian.edu. By clicking on the survey link, you agree you are a currently practicing, licensed CRNA in Indiana and agree to participate in this survey.  ...

... 1 INTRODUCTION TO CIMT SCAN Marian University Leighton School of Nursing Doctor of Nursing Practice Final Project Report for Students Graduating in August X and May __ An Introduction to Carotid Intima-Media Thickness Scan (CIMT) C arla J. Baker Marian University Leighton School of Nursing P roject C hair: oF P , . CPNP - -,.,__,.__ (Signature) Committee Member: (Date) Lisa Mil c'3,d(Signature) Date of submission: __---=------,B/1---\ +---"-I[/__ (Date) INTRODUCTION TO CIMT SCAN 4 Abstract Objective: Carotid intima-media thickness (CIMT) is utilized to predict cardiovascular risk. CIMT uses ultrasound to measure the thickness of the two innermost layers of the carotid artery. Increased plaque in the carotid arteries reduces the blood flow in the vessels, increasing the risk of cardiovascular disease. High patient satisfaction with CIMT testing may positively empower the patient to incorporate lifestyle changes to reduce the risk of experiencing a cardiovascular event. The study aims to determine the value of CIMT testing in primary care based on patient feedback. Methods: The family practice staff in Central Indiana will email an electronic questionnaire to patients who completed a CIMT scan in the fall of 2022 or the spring of 2023. The current literature will be reviewed to compare the results with the results of this study to determine if patient satisfaction with the CIMT testing influences patient motivation to change lifestyle behavior and is suggestive that CIMT testing is beneficial in family practice. Results: All respondents were extremely satisfied with the professional care they received during the procedure and the care and treatment they received afterward. One participant, or twenty-five percent, improved their dietary choices and medication compliance after the CIMT scan. None of the participants made any changes in their exercise routine. Conclusion: Additional studies using a more extensive population base would be beneficial and recommended to provide statistically significant results. All participants were happy with the CIMT scan process and their results, which suggests its use benefits patient satisfaction with cardiovascular disease risk assessment. Keywords: carotid intima-media thickness, patient satisfaction, demographics, family practice, CIMT 6 INTRODUCTION TO CIMT SCAN Some patient characteristics, such as age, gender, race, and family history of CVD, can increase the risk of cardiac disease and cannot be altered (Hajar, 2017). Addressing the comorbidities, such as weight, hypertension, hyperlipidemia, diabetes mellitus, lack of exercise, stress, and smoking, can be improved through intervention (Hajar, 2017). Screening asymptomatic individuals for CVD is instrumental in identifying those at risk of disability or death from stroke or myocardial infarction (Hajar, 2017). With the knowledge gained from carotid intima-media thickness (CIMT) scans, the provider and patient can better understand the potential CVD risks and initiate corrective measures (Korcarz et al., 2008). This study aims to determine patient satisfaction with the CIMT scan process and test results and if the level of satisfaction experienced is a motivational force to encourage the patient to incorporate positive lifestyle changes (Korcarz et al., 2008). Background As CVD is the leading cause of death in the United States, early detection of its risks and initiation of interventions for those risks could improve an individual's length and quality of life (Tai & Lu, 2021). Early detection is essential because incorporating healthy lifestyle behaviors early on is more beneficial than treating advanced atherosclerotic vascular disease (Zyriax et al., 2021). Three diagnostic tests used to detect AS are the percutaneous transluminal coronary angioplasty (PTCA), coronary artery calcium scan (CAC), and CIMT scan. Of these three tests, the PTCA is the gold standard for detecting AS in coronary arteries is the PTCA (Garber et al., 2022). PTCA is commonly performed on patients experiencing cardiovascular symptoms or as the result of positive noninvasive testing (Marwick et al., 2015). INTRODUCTION TO CIMT SCAN 7 This procedure is invasive, costly, and time-consuming and may be a source of anxiety for some individuals. (Garber et al., 2022). The PCTA is done under conscious sedation (Azura Vascular Care, 2019). A thin tube called a catheter is accessed through an artery in the groin or wrist and threaded through the vessels in the heart using imaging guidance (Azura Vascular Care, 2019). If a blockage is detected, a balloon at the tip of the catheter is inflated and compresses the plaque against the artery walls to restore blood flow to the heart (Azura Vascular Care, 2019). When the procedure is completed, the balloon is deflated and removed, along with the catheter (Azura Vascular Care, 2019). The advantages of PTCA include that the procedure is much less invasive compared to open-heart surgery, the level of anesthesia is moderate compared to general anesthesia, reducing the time spent in the hospital, and the skin is punctured to access the arteries, so no surgical incision or sutures are needed (Azura Vascular Care, 2019). Disadvantages seldom occur but may include damage to the arteries during the procedure, blood clots, reoccurrence of the blockages, and excessive bleeding at the insertion site (Azura Vascular Care, 2019). The cost of a PTCA can vary depending on where the procedure is performed (Sanger-Katz, 2019). In the United States, the price of a PTCA averages $32,000 and is typically covered by most insurance plans (Sanger-Katz, 2019). The CAC scan is a noninvasive alternative diagnostic method to determine the potential risk for CVD from AS. It is a reliable tool for predicting CDV events in asymptomatic individuals at low or intermediate risk (Shreya et al., 2021). The CAC is a low-dose CT of the heart (Grayland-Leech, 2022). Images obtained from the CAC allow doctors to determine the amount of plaque in the coronary arteries (Gray land-Leech, 2022). The greater the amount of plaque present, the greater the risk of developing heart disease (Grayland-Leech, 2022). The 8 INTRODUCTION TO CIMT SCAN CAC scan demonstrates 88.6% sensitivity and 86.2% specificity (Moradi et al., 2017). The sensitivity and specificity vary dependent on the degree of calcium present (Moradi et al., 2017). Table 1 shows CAC test scores and recommendations based on the test results. Table 1 CAC Test Scores and Recommendations Coronary calcium scan score Plaque Risk Next steps 0 none present low risk of CAD or heart attack no treatment required 1-10 minimal amounts of plaque present low risk of CAD or heart attack lifestyle changes to help prevent the score from increasing 11-100 small amounts of plaque present moderate risk of CAD or heart attack may need lifestyle changes and sometimes medication 101-400 moderate amounts of plaque that may be blocking arteries medium to high risk of CAD or heart attack medical treatments, lifestyle changes, and follow-up testing extensive amounts of immediate further testing high risk of CAD plaque that is likely to and treatment to help or a heart attack be blocking the arteries prevent heart attack *Note: This table shows the quantity of coronary artery plaque present, the risk level for heart Over 400 attack, and recommended treatment based on the coronary calcium scan score (Grayland-Leech, 2022). There are advantages to having a CAC; there is little to no preparation required for the test, the test only takes 10-15 minutes and does not require anesthesia, hospitalization is not needed, there is no recovery time, and there the test is relatively inexpensive (Grayland-Leech, INTRODUCTION TO CIMT SCAN 2022). Disadvantages include exposure to a minimal amount of radiation exposure during the test, and individuals on statin drugs or those who are pregnant are recommended not to have the test (Grayland-Leech, 2022). CAC cannot be performed on males younger than 40 or females younger than 50 (Soni et al., 2021). Individuals who cannot lie flat on their backs with arms above their heads without moving for 15 minutes should not have the test (Grayland-Leech, 2022). The average cost of a CAC scan is around $100 (Grayland-Leech, 2022). This cost is not usually covered by insurance. A CIMT scan is another noninvasive atherosclerosis imaging technique that can assist in identifying the status of plaque accumulation in vessels and predict the risk of future cardiovascular events (de Groot & Duivenvoorden, 2022). CIMT measurements are most frequently obtained using a high-resolution ultrasound, although magnetic resonance imaging (MRI) is also used (de Groot & Duivenvoorden, 2022). CIMT measurements demonstrate 78% sensitivity and 75% specificity to accurately diagnose the presence of atherosclerosis (Zaidi et al., 2020). The advantages of having a CIMT are similar to having a CAC, other than it can be performed on anyone of any age (Soni et al., 2021). There is no preparation for the test; the test only takes 10-15 minutes and does not require anesthesia, hospitalization is unnecessary, and there is no recovery time (Soni et al., 2021). The US is non-radioactive, which is an advantage over using X-rays (Acebes et al., 2016). Many hospitals in other countries are not equipped to perform PTCAs. As a result, CIMT is performed across the globe and compared to the gold standard angiography as a diagnostic test (Zaidi et al., 2020). The disadvantages of having a CIMT scan include a moderate cost of about $100 to $250, which is not covered by insurance (Soni et al., 2021). Additionally, the test lacks standardized parameters, which limits the accurate 9 INTRODUCTION TO CIMT SCAN interpretation of the results, and it depends on the operator's skills in performing the test, which results in limited reproducibility and limited availability of facilities that can perform an accurate test (Acebes et al., 2016; Soni et al., 2021). The coronary artery calcium score and carotid artery intima-media thickness indicate the presence of atherosclerosis. Pathakota et al. (2020) have conducted a study that determined a positive correlation between CACS and CIMT with the severity of CAD through SYNTAX and Gensini scores. SYNTAX and Gensini scores are two scales used to assess the severity of coronary artery disease (Safarian et al., 2014; Wang et al., 2022). This association suggests that CACS and CIMT can be noninvasive alternatives to angioplasty tests to determine atherosclerosis severity (Pathakota et al., 2020). Each test has value, and the most appropriate test for everyone can be determined through consultation between the healthcare provider and the patient. Cassola et al. (2022) caution if providers use CIMT as the only diagnostic testing method. Adding another diagnostic test may improve the accuracy of the carotid stenosis diagnosis and the risk of CVD (Cassola et al., 2022). Ultimately, the decision to pursue additional testing should be a joint decision between the patient and provider. Problem Statement In an Indianapolis-based family practice, adult patients 18 and older are provided an opportunity to voluntarily participate in CIMT testing at an out-of-pocket cost to participants. A CIMT scan with a vascular age higher than the patient's biological age may indicate that a person is at risk for CVD. CIMT scans impact the patient's perception of the need to adhere to the provider's recommended interventions, including lifestyle changes, prescription therapies, and scheduling regular follow-up appointments (Zyriax et al., 2021). Could patient satisfaction INTRODUCTION TO CIMT SCAN 11 with the CIMT testing experience at this Indianapolis clinic directly impact their motivation to consider adopting a healthier lifestyle through diet, exercise, and medication? Needs Assessment and Gap Analysis Adult patients in the Indianapolis family practice of interest are currently being screened for AS by CIMT. Knowledge gained from diagnostic testing that can improve the quality of life is referred to as planning value (Lee et al., 2010). Benefits from this diagnostic testing include providing a medical diagnosis, treatment planning, and patient peace of mind (Lee et al., 2010). The planning value of a CIMT scan is that it provides high-quality health information, which assists the individual in devising strategies for improving their lifestyle by eating nutritious foods, exercising, and taking medications as prescribed by their provider (Dom et al., 2021). This study aims to determine if patients who are satisfied with the CIMT process, cost, and convenience are more motivated to consider lifestyle improvements based on their CIMT testing results and experience. Appendix A summarizes this study's internal and external strengths and weaknesses. Theoretical Framework Theories are a summary of knowledge used as a framework for research and practice (Khoshnood et al., 2020). The Knowledge-to-Action (KTA) framework was developed by Dr. Ian Graham and his colleagues in 2006 (Registered Nurses' Association of Ontario, 2023). The KTA framework shown in Figure 2 illustrates the process of synthesizing knowledge, which is then translated into an action that ideally results in a positive outcome (Registered Nurses' Association of Ontario, 2023). 12 INTRODUCTION TO CIMT SCAN Figure 2 The Knowledge-to-Action Framework Monitor knowledge use Select, ta,1or, implement interventions .. >-........ ..OWLEOGE CREATI;:.......... \. ,(.// '1::' 'dge q ry Evaluate outcomes .-'c, / "' Assess barriers to knowledge use Adpt knowledge to local context Sustain knowledge use Identify problem -f. Identify review, select knowledge ACTION CYCLE {Application) *Note: This figure is a diagram that depicts the Knowledge-to-Action Framework flow (Graham et al., 2006). KTA framework consists of two parts, including knowledge creation and the action cycle, or application of the Knowledge (Graham et al., 2006). Knowledge creation begins with collecting the available knowledge on a topic of interest, summarizing the knowledge collected, and developing a tool to improve healthcare (Graham et al., 2006). The central portion of the framework is identified as "the funnel" because much knowledge is filtered and consolidated, forming the essence of an idea that is then used to create a tool to benefit healthcare (Graham et al., 2006). INTRODUCTION TO CIMT SCAN 13 The second component of the KTA framework is the action cycle which includes identifying an issue that needs to be changed, identifying the targeted population, identifying any barriers to change, selecting and implementing a personalized care plan for change, monitoring the knowledge application, evaluating outcomes, and maintaining the knowledge use (Graham et al., 2006). The purpose of CIMT scanning is to identify individuals at risk of CVD. The responsibility of the healthcare provider is to ensure that the patient has a positive CIMT experience, which can include providing the test at a reasonable cost of the test, ease of scheduling the test, having no preparation before having the test, a painless test procedure, and simplicity of understanding the test results. The healthcare provider must also educate the patient on the risks associated with AS. An increase of 0.10 millimeters in CIMT has been shown to increase the risk of cerebrovascular events by 18% and a 15% increase in the risk of myocardial infarction (van den Munckof et al., 2018). Abnormal CIMT scan results can provide individuals with concrete evidence of the formation of AS. Ideally, this knowledge and high patient satisfaction with the CIMT testing process will motivate individuals to adhere to their healthcare provider's recommendations tailored to their needs. Review of the Literature Literature Search A literature search was conducted utilizing the Marian University library and health professions librarian. A search was conducted for English articles that are fifteen or fewer years old in the Ovid Medline database using a focused medical subject heading "medical interview satisfaction scale," which yielded 60 articles. Another search using the subject heading "patient satisfaction AND surveys and questionnaires" yielded 2359 articles. A third search using INTRODUCTION TO CIMT SCAN 14 "surveys and questionnaires AND physician-patient relations" yielded 243 articles. The total number ofarticles found was 2587. From this subset of2587 articles, an additional search combining "primary health care OR family practice OR general practitioner" reduced the total number ofarticles to 193. A final search using the terms "ultrasonography AND patient satisfaction OR physician-patient relations" resulted in an additional 360 articles, resulting in 553 total articles. A summary ofthe literature search is shown in the PRISMA diagram in Appendix B. Appendix C shows a briefsynopsis ofthe twelve articles remaining after skimming the reports' abstracts and eliminating those not pertinent to patient satisfaction with their ultrasonography experience or their consideration in modifying lifestyle choices based on their scan results. These remaining 12 articles consist of3 systemic studies (Anokye et al., 2023; Radavelli-Bagatini et al., 2022; Rodondi et al., 2012), one prospective control trial (Mathews et al., 2018), six cross-sectional trials (Acebes et al., 2016; Anderson et al., 2021; Claret et al., 2016; Johnson, Einerson, et al., 2011; Johnson, Turke, et al., 2011; Korcarz et al., 2008), and two convenience trials (Bloch et al., 2015; Howard et al., 2014). The investigator selected these articles for their relevance to this investigation, which is to determine ifpatient satisfaction with CIMT ultrasound testing and whether high patient satisfaction translates to increased motivation to incorporate healthier lifestyle choices. Review CIMT Scan Description Healthcare providers incorporate various testing methods to predict risks for CVD in their patients. One test is the CIMT scan, which measures the thickness ofthe two innermost layers of the carotid artery (intima and media layers) by a B-mode ultrasound ofthe bilateral carotid 15 INTRODUCTION TO CIMT SCAN arteries, as shown in Figure 1 (Khatri et al., 2022). A greater thickness of the vessel lining indicates a concentration of calcified plaque deposits, which restricts blood flow (de Groot & Duivenvoorden, 2022). Typically, a CIMT scan is a collection of carotid intima-media thickness measurements of multiple arterial segments, including the right and left distal common carotid arteries, the carotid bifurcation, and the proximal internal carotid arterial segments (de Groot & Duivenvoorden, 2022). Figure 1 Carotid lntima-Media Thickness Scan Carotid duplex ICA ::::..c--.....,_- Ultrasound wand Distal CCA - ECA Origin of the Bifurcation Near Wall Proximal ::JIMT Jntlma,--:.Wall Medial Adventlta !CA- Internal carotid artery ECA- External carotid artery *Note: This figure is a diagram that illustrates measuring the CIMT on the far wall of the common carotid artery (CCA) (Khatri et al., 2022). The healthcare practice from this study chose CIMT scans provided by Vasometrics. The CIMT test is an approximately ten to twenty-minute safe and painless procedure. The technician applies a conductive gel to the skin on each side of the patient's neck and then uses a high resolution B-mode ultrasound transducer to scan the carotid arteries. The images obtained are uploaded via a secure connection into a summary report. A sample report is shown in Figure 2 INTRODUCTION TO CIMT SCAN 16 (Vasolabs, n.d.). After completing the scan, the physician reviews the results with the patient and discusses potential treatment options based on the report. Figure 2 Carotid Intima-Media Thickness Scan Report by Vasometrics VASOMETRICS: Arteriosclerotic inflammation tracking and atherosclerotic plaque assessment 53 1.390 .... 0.613- Vascular Age vc,cutar oge I, a $urmfllnt of TM oppont 090 of Y(Mlr otC.,iet Jf VOVI ..OS(u\or oq:e tS tilgMr rhcm your c-hr<>no\og:tCO.l 09t. you mav f>t a, t,19Nt rli( to, df!Yloptng (Of'GIOYO"U!Ot d1Jeoi& Carotid Intima-Media Thickness Test (C-IMT) ttuttt,..,,, (ON)hd imim left CIMT percentile, carotid plaque present Point of Care Ultrasound Improves Shared Diagnostic Understanding Between Patients and Providers Prospective Controlled Trial Lcvel3 (Mathews et al., 2018). Provision of Noninvasive Coronary and Carotid Vascular hnaging Results on Changes in Diet and Physical Activity in Asymptomatic Adults: A Scoping Review (Radavelli-Bagatini ct al., 2022). Systematic Review Level 1 To dctcnnine if point-of-care ultrasound increases understanding of a patient's diagnosis between provider and patient n =60 patients n = 10 providers Analyze current literature to identify opportunities to incorporate patients' healthy lifestyle choices to reduce the risk of CVD n=ll.256 13 observational studies and 7 RCTs Reason that brought patient to hospital, health problem, main contributors of health problem, how well patient understood health problem Patient Survey Age, weight/BM!, diet, exercise, CVD risks, hypertension, CVD risk factor status, smoking, diabetes mellitus Self-report or singleitem questions Point-of-care ultrasound (POCUS) use rcsultcd in significantly higher agreement with provider regarding diagnosis. Increased interaction between provider and patient during POCUS contributes to greater understanding by patient of health problems and diagnostic process. POCUS increases the accuracy and efficiency of diagnosis by the provider. Additional studies recommended strengthening the idea that POCUS improves the diagnostic process and patient's understanding of their diagnosis. Majority of outcomes focused on medically treating hypertension (HTN) and smoking cessation techniques. Presence of coronary artery calcification (CAC) and CVD risk factors encourages greater motivation to adopt positive lifestyle changes, with medication adherence the primary focus, while there is weak evidence for improving diet and physical activity. Have provision to provide clear advice on how to improve diet, exercise, and smoking cessation by a trained counselor. Include follow-up sessions to reiterate advice and assure understanding and compliance. Increased patient participation in the diagnostic process could provide additional understanding of patient's disease Providers need to recommend interventions that help motivate improvement in diet and exercise, with consistency and regular encouragement to be compliant. INTRODUCTION TO CIMT SCAN Reference Atherosclerosis Screening by Noninvasive Imaging for Cardiovascular Prevention: A Systematic Review (Rodondi ct al., 2012). Research Design &Level of Evidence Systematic Review Level I Purpose To determine if cardiovascular risk factors (CVRF) and patient outcomes arc improved with atherosclerosis screening 43 Population Size n=l2 Four randomized controlled trials (Ren (n=709) Eight nonrandomized studies (n=2,994) Variables Cardiovascular risk factors (smoking cessation, blood lipid control, diet change, weight loss, change in physical activities, change in adherence to medications), cardiovascular event Instruments/Data Collection Individually determined by each study due to the wide variation of screening methods and outcomes Results RCT-no improvement in CVRF, increased smoking cessation Non-RCT-incrcascd coronary heart disease (CHO) risk perception Increased anxiety after screening, promote additional invasive procedures, false sense of reassurance after a negative scan. Implications for Future Research Large-scale RCTs arc needed to make definitive recommendations for atherosclerosis screening Implications for Future Practice Further evidence is necessary before recommending widespread atherosclerosis screening for individuals INTRODUCTION TO CIMT SCAN QlO - Do you believe the process of scheduling your CIMT scan was well organized? o Strongly agree o Somewhat agree o Neither agree nor disagree o Somewhat disagree o Strongly disagree Qll - Did you have to wait more than 10 minutes before you were escorted -to the exam room for the CIMT scan? o Definitely not o Probably not o Might or might not o Probably yes o Definitely yes Q12 - Overall, was the help and treatment you received on the day of your CIMT scan satisfactory? o Strongly agree o Somewhat agree o Neither agree nor disagree o Somewhat disagree o Strongly disagree Ql3 - Overall, have you benefitted from the CIMT scan and follow-up care? o Strongly agree o Somewhat agree o Neither agree nor disagree o Somewhat disagree o Strongly disagree 46 INTRODUCTION TO CIMT SCAN Q18 - On a scale of 1-5, where 1 is low and 5 is high, how ready, willing, and able are you to improve your nutrition habits and stick to it? o Extremely low (1) o Somewhat low (2) o Undecided (3) o Somewhat high (4) o Extremely high (5) Q19 - Do you often feel tired, fatigued, or sleepy during the daytime, even after a "good" night's sleep? o Strongly agree o Somewhat agree o Neither agree nor disagree o Somewhat disagree o Strongly disagree Q20 - Has the CIMT procedure and the interpretation positively affected your dietary habits? o Strongly agree o Somewhat agree o Neither agree nor disagree o Somewhat disagree o Strongly disagree Q21 - Has the CIMT procedure and the interpretation positively affected your exercise habits? o Strongly agree o Somewhat agree o Neither agree nor disagree o Somewhat disagree o Strongly disagree 48  ...

... EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Marian University Leighton School of Nursing Doctor of Nursing Practice Final Project Report for Students Graduating in May 2023 Evaluating Effectiveness of Marian Mentorship Program Enhancements Taylor T. Bonam, BSN, RN, CCRN Marian University, Leighton School of Nursing Chair: Bradley Stelfug, DrAP, MBA, CRNA _________________________ (Signature) Project Team Members: Christina Pepin PhD RN CNE _________________________ (Signature) Date of Submission: May 5, 2023 1 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 2 Abstract Marian University utilizes a student-led mentorship program to assist fellow graduate students of Doctorate of Nursing Practice (DNP) Nurse Anesthesia Program (NAP). Marians NAP accreditor, The Council of Accreditation of Nurse Anesthesia Educational Programs (COA) found that there were opportunities for improvement in the student mentorship program (2022). In response to this, in May of 2022, there was a student-led implementation of a series of changes designed to improve the mentorship relationship between students such as; providing access to an informational website, weekly Webex meetings, and a 2-hour voluntary educational seminar. This paper is designed to evaluate the effectiveness of these changes to the student mentor program at improving the relationship between mentors and mentees. Keywords: mentorship, informational website, educational seminar, evaluate EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 3 Contents Abstract ..................................................................................................................................... 2 Contents .................................................................................................................................... 3 Introduction ............................................................................................................................... 6 Background ............................................................................................................................... 7 Problem Statement .................................................................................................................... 8 Needs Assessment & Gap Analysis: ......................................................................................... 8 Literature Search Methodology .............................................................................................. 10 Synthesis of Literature Review ............................................................................................... 11 Theoretical or Conceptual Framework ................................................................................... 12 Aim(s) and Objectives ............................................................................................................ 14 SWOT analysis ....................................................................................................................... 14 Project Design ......................................................................................................................... 16 Methods............................................................................................................................... 17 Data Collection ................................................................................................................... 17 Population ........................................................................................................................... 17 Setting ................................................................................................................................. 18 Project Evaluation ................................................................................................................... 18 Ethical Considerations ............................................................................................................ 19 Results/ Data Analysis ............................................................................................................ 20 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 4 Qualitative Analysis ............................................................................................................ 21 Outcomes ................................................................................................................................ 24 Discussion ........................................................................................................................... 24 Implications......................................................................................................................... 26 Conclusion .......................................................................................................................... 26 References ............................................................................................................................... 28 Appendix A ............................................................................................................................. 31 Figure A1 ............................................................................................................................ 31 Figure A2 ............................................................................................................................ 32 Figure A3 ............................................................................................................................ 33 Table A1.............................................................................................................................. 34 Appendix B ............................................................................................................................. 36 Table B1 .............................................................................................................................. 36 Table B2 .............................................................................................................................. 37 Table B3 .............................................................................................................................. 38 Figure B1 ............................................................................................................................ 40 Figure B2 ............................................................................................................................ 41 Table B3 .............................................................................................................................. 42 Appendix C ............................................................................................................................. 43 Figure C3 ............................................................................................................................ 43 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 5 Appendix D ............................................................................................................................. 47 Literature Review................................................................................................................ 47 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 6 Introduction The American Association of Colleges of Nursing (AACN) issued the statement that advanced practice nurses pursuing a Certified Registered Nurse Anesthetists (CRNAs) position should replace the previous masters level of education requirements and all incoming CRNAs should receive a doctoral level of education (American Association of Colleges of Nursing, 2014). Programs requiring a doctoral level of education have found that mentorship is a crucial part of that program's success (Aroke et al., 2021). Mentorship is defined by Martin & Douglas (2018) as any time a more experienced senior assists, guides, and encourages the growth of a more junior individual in a relationship of mutual accountability (Martin & Douglas, 2018). Mentorship from a fellow SRNA is deemed an essential component of success as it provides a guide to assist new students through the transition process ensuring a smooth introduction to this new phase in their life (Martin & Douglas, 2018). This new phase in a student's life involves many changes that can cause stress such as new technologies, advanced curriculum, financial difficulties, academic pressure, and changes in location and living arrangements. Due to the importance of mentorship the findings published by the Council of Accreditation (COA) were evaluated and studied to find areas where the student's mentorship program could improve (Council of Accreditation, 2022). The COA provided a summary of an electronic survey completed by the 2022 graduating class. This "Summary Report of Virtual Onsite Accreditation Review" showed that on a scale of 1-5, with 1 being extremely dissatisfied and 5 being extremely satisfied, that the average satisfaction with the student's mentorship program offered by Marian University was at 2.86, with a standard deviation of 1.22. In response, a student-led initiative began by Taylor Bonam, a member of the 2023 graduating cohort, to establish new education and resources focused on improving the EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 7 satisfaction with the student-led mentorship program and to apply them to the incoming 2025 cohort. This project is designed to observe the effectiveness of these implementations and evaluate the need for continued improvements in the utility, access, and quality of the new resources offered for the student-led mentorship program at Marian University for their Nurse Anesthesia Program (NAP). Background According to research conducted by Martin & Douglas (2018), mentors can make a significant improvement in a mentees' development in research, clinical abilities, career management, collegial networking, and personal satisfaction. Mentors benefit from the chance to share their professional achievements, gain institutional recognition, and attain experience as future leaders (Marin, J. & Douglas, D., 2018; Henry-Noel, N. et al., 2019). Successful mentorship programs are described by Ssemeta et al., (2017) as requiring a formal process with shared expectations and training adapted to the local context. Ssemeta et al., (2017) also found key themes that cause difficulty in a mentor program's utilization. These include: unclear role of the mentor, lack of mutual trust and respect between mentor and mentee, variations in identifying mentors (assigned vs. picked), lack of knowledge about the mentorship program, lack of formal structure, and insecurity from students about who should primarily initiate interactions/relationship (Ssemeta et al., 2017). Pallaria et al. (2019) addressed some of the confusion by providing a handbook on the individual roles and responsibilities of the mentee and mentor and found improved responses from students in the follow-up survey (Pallaria et al., 2019). Scott-Herring, M., & Singh, (2017) in the process of evaluating methods to establish a new mentor program for their newly hired CRNAs found that not only were education seminars desired by participants, but that such seminars also increased satisfaction and comfort in the EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 8 program among mentors. The mentees were also increasingly satisfied and reassured with their competence with their job after completing their orientation period. Both studies found that overall satisfaction and contentment were increased in the mentors and mentees following their increased education on the functioning of the mentorship program offered (Pallaria et al., 2019; Scott-Herring, M., & Singh, 2017). Problem Statement The educational seminar, provided by the Marian University student Taylor Bonam, was designed with the intention to increase knowledge on roles, utilization of resources and satisfaction of students. The new educational seminar covered communication techniques, website and contact details for resources, and provides pre-scheduled easy attendance meeting times for students to interact in. By providing incoming mentees and mentors with additional information on the student-led mentorship program in a more formalized manner, the goal is to see improved interactions between cohorts and increased utilization of resources by students. Did the educational seminar, and informational website offered successfully improve the quality and frequency of interactions between mentors and mentees? This project provided a survey to all currently attending cohorts in the NAP program at Marian University to evaluate the successfulness of the educational seminar in improving interactions from the mentee perspective of the 2025 cohort. Needs Assessment & Gap Analysis: Previously, the student-led Marian mentorship program automatically assigned a mentee to a mentor who was then encouraged to contact their mentee via email on their own time. The relationship between the mentor and mentee was non-structured and on a volunteer basis. Unfortunately, Mentees had no access to a mentor if the mentor did not initiate contact. In the EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 9 event a mentor did not initiate contact, the mentee had no formal recourse for a substitute mentor. If the relationship fell through due to personal conflict or other circumstances, the student-led mentorship program had no concept of a "no-fault opt-out" option allowing for a student to be provided an alternative mentor without consequences (Martin & Douglas, 2018). A voluntary welcoming day was arranged at the beginning of the semester, to encourage mentors and mentees to meet in person. As the mentor role for the students was undefined, responsibilities were open to interpretation. The mentor was encouraged to be available to the mentee for any questions, concerns, or practice. The mentee was encouraged to reach out to the mentor with questions or concerns, indicating some responsibility on the mentee in maintaining the relationship. As new students in a transitioning period in their lives, initiating the relationship to reach out to mentors may have been an additional stressor for mentees resulting in less communication and utilization of mentors as described by Ssemeta et al., (2017). The new mentor program was implemented to address these gaps in education and provide resources for students to. The educational seminar was a voluntary 2-hour session provided on May 10th, 2022 during the orientation week for the 2025 mentee cohort. There were no clinicals assigned for the 2024 mentor cohort during the orientation week, decreasing time or traveling conflicts that may have prevented attendance. According to Ssemeta et al., (2017), the qualities believed to be important between mentor and mentee are similar from both perspectives. Ssemeta et al., (2017) compared mentoring programs in medical schools and found that issues occurred when programs and practices were not aligned and lacked formalization. The seminars goal in having mentors and mentees both attend the educational seminar was to provide set roles and communication guidelines for the mentor and mentee interaction to follow. Previous studies by Ssemeta et al., (2017) and Lyons, McQuillin, and Henderson, (2019) believed there were several EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 10 challenges faced by mentor programs including limited mentors, poor understanding of expectations, excessive workloads preventing regular or in-depth meetings, or other responsibilities or needs that undermine the sustainability of the program. The goal was to address some of these concerns by providing an orientation week to decrease the workload on students to allow for a formal and structured time to meet, as well as to provide an informational seminar educating students on: roles and responsibilities as the mentor and the mentee, communication techniques and resources provided by the program, and demonstration on how to best utilize resources to meet regularly. These interventions were evaluated for their effectiveness to see if there is a need for further improvements in the student-led mentorship program. Literature Search Methodology A Literature search was conducted April 2022 utilizing PubMed, Medline, and Ebscohost via CINAHL databases. The search was conducted via the BOOLEAN phrase training mentorship program, OR training mentors, AND nursing. This resulted in a total of 5,590 articles from the databases utilized. A filter was applied to limit articles to those published within the last 5 years, in English and on human subjects resulting in a total of 727 articles. Articles were then manually screened utilizing inclusion and exclusion criteria for appropriate content and assessed for relevance. Relevance was determined to be a subject population of adults being mentored, with training occurring for the mentors or preceptors as an intervention. Inclusion criteria for manual search involved focus on key words, training of the mentors or preceptors, and primary sources. Exclusion criteria involved secondary research, expert opinions, or no mentor training described or evaluated. After applying inclusion and exclusion criteria 13 articles were found applicable from PubMed/Medline and 8 articles were EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 11 found from the Ebscohost CINAHL database. Of the remaining articles 3 were found to be duplicated and excluded between PubMed/Medline and Ebscohost CINAHL database leaving a total of 13 from PubMed/Medline and 5 articles from Ebscohost CINAHL database. Additionally, 2 more articles were found by mining sources for relatable content making the total 20 articles utilized in the literature review matrix. Synthesis of Literature Review Due to the diverse situations and environments in which programs are implemented across various institution literature on successful mentorship programs cover multiple methods and implementations (Martin, J. & Douglas, D., 2018). The varying success and sustainability of mentor programs can partially be attributed to mentor education and preparedness before beginning the role (Palleria et al., 2018; Ssemata et al., 2017, Sheri et al., 2019). Palleria et al., (2019) increased preparedness by issuing a handbook containing details on roles and expectations resulting in improved responses on the follow-up survey on knowledge on the program, role of a mentor, as well as the role of a mentee changing their survey responses from "agree" to "strongly agree" for a statistically significant number of students (rs = 0.999; p < 0.01). Literature on successful implementation of mentor training often emphasizes the importance of role clarification (Glover et al., 2021; MecBride et al., 2017; Palleria et al., 2018; Rohatinsky et al., 2020). Other themes in the literature showed a utilization of mentor education with a focus on communication strategies, goal setting, and feedback (Kramer et al., 2018; Mikkonen et al., 2020; Rohatinsky et al., 2020; Spiva et al., 2017; Tuomikoski, 2020). A theme for improving mentorship in RN nursing on the unit included education on Evidence-Based Practice (EBP) in attempts to encourage its usage on the unit (Evans et al., 2020. Lott et al., 2020; Spiva et al., EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 12 2017). Less common themes found in the literature review included alternative teaching methods for those suffering with Intellectual Developmental Disabilities (IDD) and education on providing accurate final assessments of mentees from Kramer et al. (2018) In addition, some articles did not go into detail on the exact nature of the education being provided to the mentors decreasing chances for replicability (Argawa et al., 2020; Kramer et al., 2018). Theoretical or Conceptual Framework As shown in Appendix A, the Change Theory of Nursing, developed by Kurt Lewin, is a three-stage model designed to successfully implement a planned change to the culture and atmosphere by replacing prior learning with new learning and maintaining new learning and habits via the "unfreezing-change-refreeze model" (Butts & Rich, p. 727, 2018). The changes are influenced by driving forces designed to destabilize the old knowledge and push towards change in the cultural atmosphere. Restraining forces are constantly fighting against change to maintain the status quo. And equilibrium is when driving forces and restraining forces are equal resulting in no change occurring at all (see Figure 1A). Context. There was a student initiative designed by Taylor Bonam to improve the current student-led Mentorship program at Marian University introduced to the 2024 and incoming 2025 cohorts. The class of 2024 was expected to provide the class of 2025 with a strong support network and mentorship. Mentors were assigned to the 2025 cohort based on the same questionnaire for compatibility via shared life experiences and goals from previous cohorts. The volunteer educational session provided to the 2024 and 2025 cohorts covered expected roles, duties, and resources available and was designed to improve satisfaction with mentorship interactions from mentees. A good mentorship experience can lead to increased access to EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 13 students, reduce stress and insecurities about roles and responsibilities, and improve the retention rate of students (Palleria et al., 2018; Nearing et al., 2020). Background. There was an important goal of achieving a support network for the incoming 2025 class. If there was trouble with a mentor how did one resolve it? Was there a phone number/e-mail to call, was there a spare mentor available to pick up anyone who had issues? What were the roles for each individual? We arranged contact, but how should the relationship progress? Previously there had been no formal process of education for the student-led mentorship program. The educational seminar provided at the beginning of the semester addressed these concerns via a PowerPoint lecture on roles and responsibilities, a demonstration of the oncourse website describing the support available for the students and ended with interactive activities for the mentor and mentee to participate in that were designed to demonstrate appropriate teaching and professional communication strategies, provide examples of frequent goal setting and appropriate feedback critique. Evidence-based practice shows simulation can be an effective education tool between mentors and mentees and by providing the interactive activity at the end allowed students to put into practice their new knowledge on communication strategies and feedback (Sheri, K., et al., 2019; Song, C. E., & Jang, A., 2021). Design. Provided the same voluntary Qualtrics survey evaluating the perspective of mentees on their mentor relationship and experience in their first year to all graduating cohorts 2023, 2024, and 2025 (See Appendix A Table 1). By providing the same Qualtrics survey to all current cohorts, a comparison was made to see if the additional resources and educational seminar that was provided to the 2024 (mentor) and 2025 (mentee) graduating class resulted in increased mentor and mentee interactions and improved satisfaction from the perspective of the students. By comparing the different graduating cohorts, we can also see if there has been an overarching EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 14 positive change surrounding the culture, expectations, and utilization of the student-led mentorship program offered by Marian University over time. Evaluate. The Qualtrics survey utilized 4 digits of student ID numbers to ensure anonymity and confidentiality of subjects and utilize a mixed-methods approach to evaluate the success of the experience and quality of the student-led mentorship program provided. The survey was distributed via an e-mailed URL link for anonymous survey responses and included multiple choice, Likert-scale responses, and free-text answers. Aim(s) and Objectives The objective of this Doctoral Nursing Project (DNP) is to measure and evaluate if the changes made to the student-led Marian mentorship program provide an improved relationship between the mentor and mentee students. The aim is to ensure a satisfactory, mutually respectful, and fulfilling mentor and mentee relationship was achieved from interventions made to the program. This DNP project utilized a mixed methods review anonymous survey evaluated by two faculty members for face validity and content validity to compare the 2023 cohort(senior), 2024 cohort (junior) and 2025 graduating class(freshman) experience with their mentors and evaluate if changes made to the program provided improved experiences. SWOT analysis Appendix A includes a SWOT analysis that describes the strengths, weaknesses, opportunities, and threats inherent to this DNP project and sample population (see Figure A2). the strengths of this DNP project include; the ease of access to the sample population. By providing the Marian University cohorts with e-mail and canvas access to the survey it was possible for every student to have access to the survey and volunteer to respond. The convenience of location at Marian University provided access if any student lacked the ability to EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 15 respond at home. Marian University as a stakeholder in the success of the student-led mentorship program could provide additional hours if the seminar is shown as beneficial or needing improvement. As this is an evaluation of a quality improvement project, a weakness of the project is that the results will be limited to the Marian University institution, the sample population will be small including volunteers from the Marian University SRNA current cohorts. As the sample population is across multiple cohorts there are location and time constraints and scheduling conflicts involved in maintaining a mentor and mentee relationship from very disparate schedules across the cohorts that may affect results. The project spanned all three cohorts, 2025, 2024, and 2023, and due to the increased time passing from the cohorts first-year experience there may be less accurate results in responses from the later 2024 and 2023 cohorts. The 2023 cohort will have the most difficulty providing accurate data due to the time between their mentorship experience (2020-2021) and the survey evaluating that experience offered. This project provides a multitude of opportunities for improvement in the student-led Marian mentorship program and student participation. Mentors can benefit from participating in the program by reinforcing their own education by sharing their own experiences, improving professional satisfaction, and increasing experience in leadership roles (Marin, J. & Douglas, D., 2018; Henry-Noel, N. et al., 2019). Filling out feedback on the survey also provides mentors and mentees with the opportunity to suggest improvements or solutions to any difficulties still experienced in the program. Unintended threats to this project may include unanticipated interfering factors affecting the relationship between mentor and mentee unrelated to the education seminar. Potential threats can include the new clinical sites offered to the 2024 graduating class leading to decreased EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 16 participation in mentoring and simulation due to the increased distance to travel to the campus location. Financial difficulties with increased gas prices can lead to decreased visits and interactions between mentors and mentees. Scheduling difficulties with increased class sizes and divided class times that the 2024 cohort experienced created more limited opportunities for arranged schedule times for mentorship between the 2024 and 2025 cohorts. The fear of reprisal or failure to maintain anonymity may result in non-participation from students in the survey or resources offered from the educational seminar. Project Design This was a quality improvement project evaluating the effectiveness and veracity of the educational seminar implemented to improve the student-led mentorship program at Marian University. This is a multi-cohort convenience sample of the incoming 2025 cohort of mentees, the 2024 cohort of mentors and the control sample of 2023 cohort completely unexposed to the voluntary educational seminar. The education provided is a 2-hour multi-modal approach to create an interactive education offering; visual demonstrations of mentoring, a PowerPoint presentation on communication techniques, goal setting and formal roles and responsibilities, a simulation experience utilizing different teaching techniques in multiple learning styles, and how to use and access the technological resources available after leaving the seminar. The Curricular content utilized in the Mentor education was curated on a review of current literature within the last 5 years on effective mentor education. The participation in the education was voluntary. In an attempt to increase interactions between mentors and mentees the education seminar included a section dedicated to encouraging weekly check-ins, self-evaluations and goal settings. Of the resources provided and discussed during the education, one was a voluntary pre-arranged Web- EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 17 Ex based meeting to increase ease of access for mentors and mentees to discuss current goals and difficulties. Methods Evaluating the quality improvement on the student-led mentorship program via the educational seminar was conducted via an anonymized Qualtrics survey that utilizes the last 4 student ID numbers to ensure anonymity and confidentiality of subjects while still allowing for an accurate correlation of responses. The Qualtrics survey, Mentee Perception of Mentor Relationship (MPMR), utilizes a mixed-methods approach that evaluates the demographics of participants (cohort, age, gender, previous experience mentor education), the frequency of contact between mentor and mentee, Likert-style questions on satisfaction with the mentor, and commentary on those experiences or suggestions for improvement (See Table A1). Data Collection The Qualtrics Survey was be offered on the Oncourse website as well as provided via an email URL link for anonymous survey response with multiple choice, Likert-scale responses, and free-text answers to the cohort. Population Participants selected came from a convenience sample population from the Marian University SRNA students in the 2023 cohort, 2024 cohort and the incoming 2025 cohort. The 2023 and 2024 cohorts are considered the control samples, due to their mentors remaining unexposed to the educational seminar offered while they experienced their first year in the program as a mentee. In total there were 41 completed responses used in the study with a majority of responses completed by the 2025 cohort demonstrated in the bar graph in Appendix A (see Figure A3). Demographic data of participants is listed in Appendix B in Table B1. Responses were evaluated with SPSS IBM software to analyze frequency of demographic data EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 18 via descriptive statistics for covariates and outcomes (Table B1). Descriptive statistics listed in Appendix B found that approximately students 48.8% (n=20) were in the 2025 cohort, 24.4% (n=10) were in the 2024 cohort, and 26.8% (n=11) were in the 2023 cohort (see Table B1). Demographics of the survey conducted showed a majority of female respondents at 63.4% and with the remaining respondents listing as male at 36.6% (see table B1). Participants were asked to describe themselves and the majority responded as 68.3% (n=28) as white or Caucasian with the following responding as either 7.6 % as African American, 12.2% Asian, or 12.2% Latino, Hispanic, Spanish or Other (see Table B1). Setting This project is set at Marian University academic center in Indiana in the mid-western region of the United States. Due to the nature of this quality improvement project results will have limited applicability to any outside institutions beside Marian University. Project Evaluation The MPMR survey was previously unused and has no reliability data. The survey has been evaluated by two faculty members for face validity and content validity. The responses from the MPMR survey were collated and coded into a statistical computing program with the last four digits of student ID's utilized to maintain anonymity of participants. The mixed-method survey review had responses categorized according to type: ordinal, nominal, continuous, discrete, or qualitative text-box responses and compared via ANOVA testing for analysis of variances between cohorts. The free-text responses shall be evaluated by an additional two faculty members to ensure investigator triangulation in coding of themes for content and validity. Independent variables depend on attendance in the simulation education and participation in offered Web-Ex meetings between mentors and mentees. Other independent variables that EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 19 may affect results include, previous education or experience mentoring, time between experience as a first-year mentee, age of participants, or gender. The dependent variables assessed include the Multiple choice and Likert style questions on the frequency of interactions between mentor and mentee, and degree of satisfaction with those interactions. Once data was organized and recorded, a descriptive statistical analysis was conducted utilizing an ANOVA test to determine if there was a relationship between receiving additional education on the student-led mentorship program and the mentee perception of their mentor relationship. The ANOVA test comparing two means and correlation of data will be able to demonstrate if there is a statistically significant difference between the independent variables and education intervention and the resultant mean evaluation scores of the perceived mentors effectiveness via the Mentee Perception of Mentor Relationship. The Qualitative responses on the Mentee Perception of Mentor Relationship (MPMR) will be evaluated and coded using thematic analysis and scanned for themes and sub-themes via two independent faculty members (Braun & Clarke, 2006). Any discrepancies can then be discussed between the coders after separately reviewing results to prevent bias from forming when sharing individual findings on the responses. Ethical Considerations This Quality Improvement project was designed to maintain anonymity of participants by utilizing the last 4-digits of the student ID to track correlation of data and prevent any bias or fear of reprisal from students. The results of the survey shall remain in the hands of the principal investigator and two faculty members assisting with validity via investigator triangulation in finding common themes in free text answers. The faculty and principal investigator student will EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 20 review and find common themes separately to prevent bias. Results of the study will not be released until after the study is complete to prevent any alterations of results. Results/ Data Analysis Descriptive statistics were obtained via SPSS statistics IBM to describe the demographics of the sample population and are listed in Appendix B, Table 1. The cohorts were compromised of 48.8% (n=20) were in the 2025 cohort, 24.4% (n=10) were in the 2024 cohort, and 26.8% (n = 11) were in the 2023 cohort (see Table B1). Next multiple Pearson correlation coefficient analyses were conducted to examine the strength and direction of relationship between cohorts and various variables. Assessing the relationship between cohorts and how satisfactory a mentee considered the usefulness of their mentors services revealed no statistically significant results (p = .16). Appendix B contains 2 graphs: Figure 1 demonstrates a visual representation via a bar graph of the individual cohorts and the frequency of mentees initiating contact, Figure B2 contains a bar graph depicting a visual representation of the cohorts and the frequency of mentors initiating contact (see Figure B1, B2) Assessing the relationship between cohorts and frequency of contact initiated by the mentor found a statistically significant relationship between variables. A moderate negative correlation was found to be significant (p < .05) indicating a linear (r (39) = -.341, p = 0.029) relationship between variables. A second Pearson correlation coefficient was calculated for assessing the relationship between cohorts and contact initiated by the mentee. A stronger moderate correlation was found (r (39) = -.537, p < .001) to be significant indicating a linear relationship between variables. The 2025 cohort was found to be initiating more interactions compared to the later cohorts. Regression results are available in Appendix B Table 2. EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 21 A one-way ANOVA analysis utilizing Tuskeys HSD was conducted to compare the 2025, 2024 and 2023 cohorts and their average frequency of mentor-initiated interactions. A significant difference (p=.028) was found between groups of cohorts (F(2,37) = 3.956, p < .05). The Tuskeys HSD demonstrated the 2025 (M = 3.10, sd = 1.07) scored a higher average of mentor-initiated interactions than the 2024 cohort (M = 2.11, sd = 1.05) and the 2023 cohort (M = 2.18, sd = 1.07). Comparing individual cohorts revealed a non-significant relationship between the individual groups (see Table B3). A second one-way ANOVA analysis utilizing Tuskeys HSD was conducted comparing the different cohorts and their average frequency of mentee-initiated interactions (see Table B3). A significant difference (p < .001) was found between groups of cohorts (F(2,37) = 12.390, p < .05). The Tuskeys HSD demonstrated the 2025 (M = 2.9, sd = .718) scored a higher average of mentor-initiated interactions than the 2024 cohort (M = 1.6, sd = .843) and the 2023 cohort (M = 1.8, sd = .789). Comparing individual cohorts revealed a non-significant relationship between the 2023 and 2024 groups (p = .830). Qualitative Analysis The survey provided in Appendix A Table 1 asked participants to respond to three open ended qualitative questions which were then separately examined to triangulate themes and codes by two faculty members and the author. The full list of themes and codes can be found in Appendix B Table 3. Four themes were found from the free-text responses; 1. Responsiveness of mentor 2. Study assistance 3. Practice of Skills and 4. Preferences/desire. The first qualitative free-text response asked participants to describe a typical experience with their mentors and was found to have three codes. These codes included: minimum to no contact with their mentor past the introduction, discussion of tips and tricks, and lastly check-ins EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 22 from mentors on well-being. Unfortunately, there was a trend for respondents to the survey to say that their own mentor was unavailable with 12 mentioning their typical interaction as unresponsive. A typical comment demonstrating their mentors unresponsiveness included statements such as, I think she was kicked out and never responded to me, or She hasnt reached out since first semester unless she needed a contact info from me for her ACLS renewal. In some of those cases a respondent took initiative to find a new adopted mentor by reaching out and is exampled in statements like, My assigned mentor never replied after the initial introduction. So I adopted a mentor and she has been fantastic or Not much help. I have spent most of the time going through another students mentor. Respondents who had their mentor respond mentioned typical interactions including tips and tricks for class or clinical a total of 10 times. A typical example of a response we received about a mentor providing assistance in studying includes, I have contacted them about suggestions for apex, study tips that worked well for them and got a quick response. I havent needed anything else. Lastly, we found that there was a trend for mentors to check-in on their mentee to evaluate their in general well-being. This was exemplified in responses such as, My mentor and I check in once a month or so just to see how things are going. It's informal, but always nice to chat and they've always been a source for encouragement. The second free-text response question asked for students to describe the top three things their mentor did for them or wished a mentor had done for them. Most students listed 2 themes consistently as their best mentor experience: 1. study tips for our didactic courses or 2. assistance in simulation (sim) lab. Study tips to prepare for class was mentioned the most with a total of 16 statements focusing on studying as either extremely beneficial or desired from their mentor. One respondent stated, I wish my mentor was available for sim time more 2) study tips for different EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 23 classes and professors would be good 3) I would have liked to have a chance to maybe shadow my mentor in the OR once before starting clinical myself. Assistance in the simulation lab on skills was mentioned a total of 9 times in comments. Respondents made frequent statements mentioning simulation lab in their top three list such as Simulation & skills experience/knowledge, answering questions (mostly about the program, less knowledge type things), reassurance or I wish I had more opportunities with my mentor in lab. Answering my questions about upcoming courses and information about clinicals would be helpful also. There was a resulting overlap in themes due to some of these responses falling under the fourth theme of wishing and preference as well as under the theme individual themes of studying or skills. Due to the increased variety from respondent on a third mentor experience, there was also a limited the ability to find a single common thread from respondents. Some repeated responses from participants included focus on mentors providing information on future clinical sites, increasing social interactions outside school, or others focused a preference on assistance with time management or handling stress. The final third free-text response question on the survey asked students if respondents had any suggestions for improving the student-led mentor program. This question found two codes within the theme of desire and preference: 1. Improved experiences with mentors and 2. Improving the matching process between mentors and mentees. The first theme of respondents focused on encouraging or enforcing positive experiences between mentors and mentees. This was stated in comments such as, Mentor mixer at the beginning of your first year and then again half way through? and Some type of mandated contact and tracking could be useful to ensure that mentors are actually engaging with their mentees. EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 24 Multiple respondents noted that there was a lack of transparency in the matching process and desired to improve or know what was involved in the process. The focus on the matching process varied in positive and negative views and are exhibited in statements like, I feel the pairings for the class of 2024 to the class of 2025 were done without consideration. The incoming students list their interests and family/support situations on the survey. Consideration should be taken to put people from similar backgrounds together. Such as someone with children should be paired with someone else who has children if possible, not with a single person in their mid 20's who does not understand where the other person is coming from. While another commented praising the success of their matching also desired more transparency in the decision process I think there should be a more outlined matching process. I really like my mentor and although our communication may be less it is still often enough to fufill my needs without being overbearing. I know that I want a mentee that is similar and will provide a similar relationship. While both views desired transparency the comments described the success of the current matching process very differently. Outcomes This DNP project is evaluating the efficacy of changes made to the student-led mentorship program at Marian University by providing a needed in-depth look at the mentee perspective of the program. Mentorship programs are essential in providing students with support through the rapid changes that come with becoming a full-time student (Martin & Douglas, 2018). As the mentorship program is a student-led initiative it is important to take the time to continually evaluate its effectiveness as students continue to move on and the program evolves. Discussion EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 25 This project had a total of 41 respondents from all three cohorts. Our results showed that after the introduction of the education seminar in the orientation process there was a following successful increase in interactions initiated by mentors as well as interactions initiated by mentees between the 2024 and 2025 cohort. This successful increase in interactions, however, did not show a statistically significant result of mentees finding their interactions to provide mor utility compared to the previous cohorts. Overall, we found that there was a desire for improvements to the student-led program as many participants stated they found interactions and matches with their mentors to be capable of improvement. There was a consistent trend in respondents to desire increased opportunities to interact with their mentor while in the school setting and out in social settings. One of the major limitations of this project was the massive change in students accepted n the program from cohort to cohort. The 2023 cohort had 20 students while they were responsible for mentoring the 2024 cohort of 32 students. Some students had to shar their mentor with another mentee and this limited interactions. This could have affected results in determining a correlation between the educational seminar and following increase in the 2025 cohorts interactions with their mentors as there were enough mentors to provide mentees with individual attention. Strengths of this project included a readily available sample population and an increased response rate from students receiving the survey at >30% from all three cohorts. BY including a mixed-methods approach we were able to compare perception of interactions between mentors and mentees such as open-ended questions on interactions as well as more objective data based on frequency of interactions. There was no collusion between faculty members or author preceding the individual evaluations of participants responses to prevent any bias and maintain content and validity when triangulating for themes and coding (Braun & Clarke, 2006). EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 26 The goal of this DNP project was aimed at assessing the current student-led mentorship program and evaluate if the educational seminar implemented for the 2025 cohort demonstrated any improvements from the mentee perspective compared to the other 2024 and 2023 cohorts. Despite finding no statistically significant results indicating an improved utility or perspective on interactions the project did find an objectively increased number of interactions in the 2025 cohort. Upon evaluation of the free-text response portion of the project there is a distinct improvement there was found suggestions for further improvements that could be made in the student-led program. Implications The qualitative portion of this survey provided many useful suggestions and ideas from the respondents on ways to improve the current student-led initiative. For example, there were multiple suggestions from respondents on ways to encourage the relationship between mentors and mentees. Multiple suggestions involved increasing formal arranged get togethers between the mentors and mentees. Another suggestion involved arranging an earlier introduction so mentors could assist mentees in preparing for classes before arriving to campus. An easily implementable suggestion was to arrange a set list of material for mentors to cover to increase likelihood of mentors responding and having a pre-set list of topics to cover. Another suggestion involved mandated contact and tracking that would be much more difficult to enforce with a student-led initiative. Conclusion In conclusion this DNP project was developed to evaluate whether the new implementation of an educational seminar provided any improvements to the student-led mentorship program. Results were found that showed that the educational seminar demonstrated statistically significant improved frequency of interactions. The qualitative portion of the project provided a EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 27 unique perspective on ideas that can be used for improving the student-led mentorship program at Marian University in the future as well. EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 28 References American Association of Colleges of Nursing (AACN). AACN Position Statement on the Practice Doctorate in Nursing. AACN; Oct. 2004. Accessed December 12, 2020. https://www.aacnnursing.org/Portals/42/News/Position-Statements/DNP.pdf Aroke, E. N., Wilbanks, B. A., Hicks, T., Thurston, K. L., & McMullan, S. P. (2021). Mentoring Team Projects for the Doctor of Nursing Practice: Considerations for Nurse Anesthesia Faculty. AANA Journal, 89(5), 435442. Butts, J. B., & Rich, K. L. (Eds.). (2018). Philosophies and Theories for Advanced Nursing Practice (3rd). Jones & Bartlett Learning. Braun, V., & Clarke, V. (2006). Using Thematic Analysis in Psychology. Qualitative Research in Psychology, 3(2), 77-101. https://doi.org/10.1191/1478088706qp063oa Council of Accreditation. (2022). Summary Report of Virtual Onsite Accreditation Review. [Unpublished raw data]. 92-93. Marian University Henry-Noel, N., Bishop, M., Gwede, C. K., Petkova, E., & Szumacher, E. (2019). Mentorship in Medicine and Other Health Professions. Journal of Cancer Education: The Official Journal of the American Association for Cancer Education, 34(4), 629637. https://doi.org/10.1007/s13187-018-1360-6 Hoover, J., Koon, A. D., Rosser, E. N., & Rao, K. D. (2020). Mentoring the Working Nurse: a Scoping Review. Human Resources for Health, 18(1), 52. https://doi.org/10.1186/s12960-020-00491-x EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 29 Lyons, M. D., McQuillin, S. D., & Henderson, L. J. (2019). Finding the Sweet Spot: Investigating the Effects of Relationship Closeness and Instrumental Activities in Schoolbased Mentoring. American Journal of Community Psychology, 63(1-2), 8898. https://doi.org/10.1002/ajcp.12283 Martin, J. & Douglas, D. (2018). Faculty Mentorship: Making It Work Across the Career Continuum Through Development, Implementation, and Evaluation of a Formal Mentorship Program. Nursing Education Perspectives, 39(5), 317318. Nowell, L., Norris, J. M., Mrklas K., White, D.E. (2017). A Literature Review of Mentorship Programs in Academic Nursing. Journal of Professional Nursing, (33)5, 334-344. https://doi.org/10.1016/j.profnurs.2017.02.007. Nearing, K. A., Nuechterlein, B. M., Tan, S., Zerzan, J. T., Libby, A. M., & Austin, G. L. (2020). Training Mentor-Mentee Pairs to Build a Robust Culture for Mentorship and a Pipeline of Clinical and Translational Researchers: The Colorado Mentoring Training Program. Academic Medicine: Journal of the Association of American Medical Colleges, 95(5), 730736. https://doi.org/10.1097/ACM.0000000000003152 Oftadeh, M., Vo, C., Reardon, B. & Weiss, L. (2021). Mentorship: An Anesthesiology Training Essential. ASA Monitor, 85 (4), 11-12. doi: 10.1097/01.ASM.0000742644.22436.82. Pallaria, T.J., Meringer, P., Brander, R., & McLaughlin, M. (2019). Effects of a Structured Mentorship Program Handbook on Student Knowledge Within a Nurse Anesthesia Program. International Journal of Nursing and Health Care Research, 7. https://doi.org/10.29011/IJNHR-090.100090 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 30 Scott-Herring, M., & Singh, S. (2017). Development, Implementation, and Evaluation of a Certified Registered Nurse Anesthetist Preceptorship--Mentorship Program. Journal of Continuing Education in Nursing, 48(10), 464473. https://doi.org/10.3928/0022012420170918-08 Sheri, K., Too, J., Chuah, S., Toh, Y. P., Mason, S., & Radha Krishna, L.K. (2019). A Scoping Review of Mentor Training Programs in Medicine Between 1990 and 2017. Medical Education Online, 24(1). https://doi.org/10.1080/10872981.2018.1555435 Song, C. E., & Jang, A. (2021). Simulation design for improvement of undergraduate nursing students' experience of evidence-based practice: A scoping-review protocol. PloS one, 16(11), e0260238. https://doi.org/10.1371/journal.pone.0260238 Ssemata, A. S., Gladding, S., John, C. C., & Kiguli, S. (2017). Developing Mentorship in a Resource-limited Context: A Qualitative Research Study of the Experiences and Perceptions of the Makerere University Student and Faculty Mentorship Programme. BMC Medical Education, 17(1), 123. Van Patten, R. R., & Bartone, A. S. (2019). The Impact of Mentorship, Preceptors, and Debriefing on the Quality of Program Experiences. Nurse Education in Practice, 35, 63 68. https://doi.org/10.1016/j.nepr.2019.01.007 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 31 Appendix A Figure A1 Theoretical Framework refreeze Unfreezing Education: Multi-modal, interactive, and voluntary Increased Contact Professional communication Goal Setting, Feed-back Maintain new changes for 1st year Note: Change Theory of Nursing by Kurt Lewin 2023, image created by Taylor Bonam EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 32 Figure A2 Swot Analysis S Strengths W Weaknesses O Opportunities T Threats Easily available sample population Literature available Information available on successful implementation at other sites Small sample population Time constraints Participation of students change of perspective occuring over time effecting comparison between samples Increased enrichment Increased participation of students in mentor/mentee program Improved student satisfaction and retention with Marian doctoral program (Sheri K. et al., 2019) Transportation/Financial difficulties in maintaining physical presence Fear of reprisal lack of anonymity Scheduling difficulties preventing participation SRNA's mandatory education session not randomly selected threatening internal and external validity Sample Size limited and from 1 facility threatening external validity Note: SWOT analysis created 2022 by Taylor Bonam EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Figure A3 Cohort Participation Bar Graph Note: Bar Graph created by Taylor Bonam demonstrating the disparity of responses from the different cohorts. 33 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Table A1 Survey: Mentee Perspective of Mentor Relationship - Your 1st year Questions By participating in this voluntary survey, you agree to participate in this DNP project What is the last four digits of your student ID number? (this shall remain anonymous and is only used to correlate responses) Which cohort graduating class are you a part of? What is your gender? What is your age? Did you move states to participate in this program? How would you describe yourself? Please select all that apply. Outside of the Marian program have you ever participated as a mentee in an official mentorship program (not a preceptor program as a RN)? Have you had any experience or training on being a mentor before the Marian Mentorship program? Did your mentor initially contact you? How often does your mentor contact you? How often do you contact your mentor? 34 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Do you contact your mentor when you have issues? If you answered 'No I do not contact my mentor if I have issues' can you explain why: How useful do you find the services provided by your mentor? What service did you find most useful from your mentor? If you have a problem with your mentor do you know your options? Write about a typical experience you had with your mentor? (This includes if your typical experience was no contact) What are the top three things your mentor did for you? Or if your mentor did not assist you, can you list three things you wish your mentor had done for you? Any additional ideas or comments to improve the student-led mentor program? Note: Frequency Table showing the three cohorts participating in this DNP project. 35 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Appendix B Table B1 Descriptive Statistics: Populations Cohort Frequency Percent 2025 (value of 1) 20 48.8% 2024 (value of 2) 10 24.4% 2023 (value of 3) 11 26.8% White 28 68.3% Black/African American 3 7.3% Asian 5 12.2% Hispanic, Latino, Spanish & Other 5 12.2% Male 15 36.6% Female 26 63.4% 20-29 years old 11 26.8% 30-40 years old 23 56.1% >41 years old 7 17.1% Note: Frequency Table showing the three cohorts participating in this DNP project. 36 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 37 Table B2 Regression Analysis Beta Group Cohorts Variables (Value) Coefficient Sig. (1-tailed) Mean 2025 Cohort (1) MIC 1 = <.001 1.78 2024 Cohort (2) MIC 2 = .015 2023 Cohort (3) Mentee Initiating None (1) Contact (MIC 1) Once a Semester (2) -.537 2.3 -.341 2.68 Once a Month (3) Once a Week (4) Mentor Initiating None (1) Contact (MIC 2) Initial Contact (2) Once a Month (3) Once a Week (4) Note: Frequency Table showing regression analysis demonstrating strength of relationship between cohort and frequency of initiating interactions of the participants in this study. **Other option responses removed from calculation. EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 38 Table B3 One-Way Anova Results Group Cohort Totals Variables (Value) N 2025 Cohort (1) 20 3.10 .240 2024 Cohort (2) 10 2.11 .351 2023 Cohort (3) 11 2.18 .325 2.9 .718 1.6 .843 1.8 .789 3.10 .240 Mentee Initiating Contact (MIC 1) Btw Groups 2025 Cohort (1) 2024 Cohort (2) 2023 Cohort (3) 20 10 10 Mentor Initiating Contact (MIC 2) Comparison 2025 Cohort (1) 20 Sig SD <.001 vs. Cohort 2024 <.001 Cohort 2023 <.002 vs. Cohort 2025 <.001 Cohort 2023 .830 vs. Cohort 2025 <.002 Cohort 2024 .830 Btw Groups .028 vs. Mean EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 2024 Cohort (2) 2023 Cohort (3) 9 11 Cohort 2024 .068 Cohort 2023 .070 vs. Cohort 2025 .068 Cohort 2023 .988 vs. Cohort 2025 .070 Cohort 2024 .988 39 2.11 .351 2.18 .325 Note: One-way Anova Table showing regression analysis demonstrating different frequencies of initiating interactions by cohort. **Other option responses removed from calculation EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Figure B1 Frequency of Mentee-Initiated Contact 40 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Figure B2 Frequency of Mentor-initiated Contact 41 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 42 Table B3 Qualitative Themes and Codes Themes Codes Responsiveness No contact/minimal Frequent contact/Check-ins Study Assistance Prepare for class Practice of Skills Simulation Lab time Prepare for Clinicals Preferred/Desire Mentorship Experience Improvements to program Note: Table describing Qualitative Themes and Codes found in responses to MPMR survey EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Appendix C Figure C3 Gantt Chart 43 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 44 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 45 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 46 EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 47 Appendix D Literature Review Citation First Author, Year. Title. Agarwal et al., 2021 Mentoring Students with Intellectual and Developmental Disabilities: Evaluation of Role-Specific Workshops for Mentors and Mentees. Research Design & Level of Evidence Mixed Methods Level 4 Population / Sample size n=x Major Instrument / Variables Data Independent collection Dependent Mentors (n = 31) Communicati on Workshop Education on Mentees (n= Disabilities 35) Awareness workshop Web-Based survey utilizing RedCap CINAHL Developing Nurses Through Mentoring: It Starts in Nursing Education. Mentors had statistically significant improvement in communication post education (M = 0.667, Post-M = 0.789, p = 0.021) There was also an increase in Disabilities Awareness Disability Awareness workshop (M = 0.633, Post-M = 0.750, t(17) = 4.507, p = 0.000). There was no significant change with program basics workshop and the essential skills mentor workshop. Improvement in role specific knowledge and skills in those mentoring students with Intellectual Developmental Disabilities (IDD) Evans, 2020. Results Cohort Study Mentors; N= 66, Level 5 RNs; N=367 Training Confidence Skills Organization al search of EBP research Convenience sample utilizing flyers Utilizing a Pre & Post-test on mentors provided with education on; didactic instruction, resource locations, and EBP culture. Evans found that post the training there were EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 48 Show effectiveness of mentor training on mentor confidence, skills, and organizational search of EBP research Fornari ete al., 2018. A Mixed-Methods Approach to Humanistic Interprofessional Faculty Development. Mixed Method systematic review Mentors: N= 169 Faculty: N= 61 Level 4 10-months of small group work to improve humanistic mentoring skills Selfperceived humanistic teaching and mentoring skills Friday V. E. (2020). Reciprocal Mentoring: An Innovative Clinical Exercise for Nursing Education. Descritpti ve Correlatio nal Mentors: N= 10 Mentee N= 10 Reflective Journals from reciprocal Mentors and Facilitators were chosen through track records and nomination and asked to participate in the survey Reflective Journals were read and coded improved results for confidence t = 6.36, p < .001, perception of knowledge, t = 5.65, p < .001, skills t = 6.73, p < .001, and ability to utilize EBP and research by t = 8.25, p < .001. The health care professional mentors found statistically significant improvement in their self-perceived teaching and mentoring over two OSTE sessions. Cohort one found improvement on being outstanding role models at relationship building with Mean (M)= 4, 4.3 Standard Deviation (SD) = 0.8, 0.7 and p = <.001. Cohort two also found had improvement on being outstanding role models at relationship building with Mean (M)= 4.1, 4.3 Standard Deviation (SD) = 0.8, 0.6 and p = <.001. 3 mentees stated they had increased desires to work with older adults, 8 students reported an improved EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Level 6 Glover et al., 2021. Descriptiv e Study NA Level 6 Nurturing Novice Faculty: Successful Mentorship of Nurse Practitioners. Hancock, 2022. Implementation and Evaluation of a Cloud-Based, Evidence-Based Nurse Mentor Training Program. Mixed Method; Level 4 Nurses: (n= 28) 49 mentoring; increased knowledge, new skills, change in perception of older adults Formal training; peer-to-peer interactions; weekly mentoring activities; Mentor feedback form; Creating a supportive environment for mentees Mentor etraining course; knowledge, skills, confidence, beliefs, values manually to find themes. appreciation for older adults and increased empathy Mentor The cohort concluded that all feedback form learning objectives were successfully achieved and unforeseen objectives were even met (impromptu writing workshop). Recruitment flyer distributed via e-mail and pre/post test via REDCap a secure webbased collection of participant replies 78% of participants would recommend the course and statistically significant improvements were seen in post test scores for knowledge (M= 0.8, p = .001) skills (M= 0.29, p=<.001), beliefs (M= 0.27, p=<.001) and confidence (M=0.27, p=<.001), but not in values (M=0.06, p= .352). EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM CINAHL Helminen, K., Johnson, M., Isoaho, H., Turunen, H., & Tossavainen, K. (2017). Final assessment of nursing students in clinical practice: Perspectives of nursing teachers, students and mentors. Descriptiv e Correlatio nal Study Level 5 Teachers (n= 108); Nursing Students (n= 278) Mentors (n= 225) Kramer, et al., 2018. Qualitativ e Study NA 50 Evaluation of perspectives of Teachers, students and mentors of final assessment given by mentors to the nursing students Questionnaire supplied by Head nurses to select mentoring staff, teachers supplied questionnaire at personnel meetings, students provided questionnaire, Students filled out the questionnaire in a classroom setting Mentors are trained to conduct the final assessment and meet sign-off requirements (Helminen et al., 2017). Of teachers (M=2.54) and students (M = 2.14) the students found the mentor assessment to be statistically significantly fairer and more consistent than teachers. Mentors (M = 1.83) and teachers (M = 1.59) both had statistically significant beliefs that there were more considerations made for multi-professional views than students (M= 1.45). Students considered the teachers to a statistically significant degree (M= 2.73) less physically present at the final assessment than Mentors (M =2.85) and teachers (M= 2.90). Mentors received up Journal statements Through the journal statements it was found that EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Developing a Culture of Caring and Support Through a Peer Mentorship Program. Level 6 Lott et al., 2020 Mixed Methods The implementation of an evidencebased practice mentoring program. Level 4 NA 51 to 2 hr training sessions on teaching and management of sessions, journal log, mentees signed contract to attend sessions Mentors participated in a 2-hour education session on EBP, EBP booklet provided via internet; measured mentor confidence levels, and measurement of EBP projects presented to clinical excellence council. mentees felt improved success in courses and testtaking skills. Journal statements from mentors showed in creased confidence in their own skills and preparation for NCLEX. The EvidenceBased Nursing Practice SelfEfficacy Scale, Investigator Needs Assessment The Average EBP selfefficacy score was evaluated three times, preeducation (72.7%), after education (87.1%) and 3 months later (90.8%) with a p<.01 indicating all values were statistically significant. There was a 300% increase in EBP/ quality improvement projects conducted by staff presented to the council within the first 6 months of the mentor education and program (6 new) EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM McBride, et al., 2017. Building a mentoring network. Nursing outlook Descriptiv e Correlatio nal Mentee responses (n= 112) Level 5 Michel-Schuldt et al., 2018 Continuous professional development of Liberia's midwifery workforce-A coordinated multi-stakeholder approach. Descriptiv e Study Level 6 52 Mentor specific education on role/resource, Effectiveness rated by mentee Mid-wives (n= 24) Certified training and mentoring (mentors received training on national, central and health facility individual basis and conducted regular visits with midwives.); Engagement The Mentorship Effectiveness Scale, Mentorship Profile Questionnaire and the Mentorship Effectiveness Scale through email and in person meetings Continuous Professional development (CPD) model Logbook of training, assessment every three years The primary nursing mentor was rated consistently over five years very high after training using the Mentor effectiveness scale (on a 0-60 point scale) mentors were rate at 55 (25 respondents out of 30), 54 (29 respondents out of 30), 55 (19 respondents out of 24), 56 (20 respondents out of 24) and lastly 58 (19 respondents out of 24). The CPD program is monitored and controlled by the Liberian Board for Nursing and Midwifery. A baseline was observed in 2026 before study implemented in 2017. Results are still being correlated however his paper is designed to highlight the positives obtained by coordination between regulatory bodies and health authorities. EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Mikkonen et al., 2020. Development and Testing of an Evidence-Based Model of Mentoring Nursing Students in Clinical Practice. Nearing et al., 2020. Training Mentor-Mentee Pairs to Build a Robust Culture for Mentorship and a Pipeline of Clinical and Translational Cross Sectional Survey Mentors: N=1360 Level 5 Aggregate d results of 3 cohort studies 53 Mentor characteristic s, reflection Mentors motivation, goal orientation and feedback N = 79 mentors N = 79 Mentees 4-day long mentor education sessions throughout the year Mentors Competency Instrument (MCI) tested by Confirmatory Factory Analysis (CFA). A survey was delivered electronically in Spain and Finland with a cookie check system to prevent repeat entries and in paper format with an anonymous envelope to return the questionnaire in Lithuania, Slovenia and Italy Email of Qualtrics survey to participants They found a positive motivation and desire to mentor heavily predicted positive mentoring practices high levels of mentor's characteristics (0.71) leading to improved mentoring practices (0.61). Reflection was a major positive influence on constructive feedback at 0.79 and goalorientation at 0.65. reflection during mentoring enhances constructive feedback between mentor and student (0.79) and this competence improves goal-orientation (0.65). The effective goalorientation improves mentor's competence of student-centered evaluation (0.79). Nearing et al, 2020 found that there was a need for training as evidenced by a wait-list and repeat attendees after the year had past. After the training there was a self- EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Researchers: The Colorado Mentoring Training Program Nelson et al., 2018. Faculty and Student Perspectives on Mentorship in a Nursing Honors Program. Level 5 Descriptiv e Analysis 54 Discussion and surveys Students; N=142 (23%) Level 5 Faculty; N=24 (38%) Improve confidence, networks and skill Faculty Perspective on mentorship and mentees Student Perspective on mentorship and mentees Nguyen, V., Forbes, H., Mohebbi, M., & Duke, M. (2018). Descriptiv e Survey The effect of preparation strategies, qualification and professional background on clinical nurse educator confidence. Level 5 Clinical Nurse Educators (CLiNEs) (n= 334) 8 institutional specific preparation methods identified with individuals receiving 3-4 different ones on average, reported improvement in confidence (+0.08, p< .001), expansion of peer networks (+0.23 p< .001), and improved technical and mentoring skills. E-mail Nelson et al., 2018 found distribution of that there was a common unpublished theme that mentorship relies pre-existing heavily on facilitation and open-ended engagement and needs to survey become less of a one-way role, but change to a collaboration style to improve mentees potentials. Nelson et al., 2018 found that mentees have a theme of engagement and accountability in the partnership with mentors. 343 paper and Comparing different Clinical 13 web based Nurse Educators found that surveys workshops offered by the utilizing the institution increased Clinical Nurse confidence more (M=3.22) Educator Skill than an increases in a year of Acquisition experience increased it by Assessment (M= 0.30). CLiNes with tool informal mentorship had a (CNESAA), (M = 3.25) decrease in perceived confidence compared to counter parts. EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM 55 CLiNE confidence in skills Rohatinsky, N., Cave, J., & Krauter, C. (2020). Qualitativ e Study Establishing a mentorship program in rural workplaces: connection, communication, and support required. Level 6 Mentors (n=43) Mentees (n=15) Education provided via handbook, PowerPoint, and orientation session, Qualitative analysis themes on connection, benefits, support Pedagogical courses showed an almost double increase in in perceived confidence. Telephone interviews transcribed verbatim and thematically analyzed All the respondents found the orientation beneficial in preparation to mentor. Connection and community were found to be a key theme in the interviews and found those with increased feelings of connection and community were more willing to star in rural positions. Support was another key theme and was found to indicate positive relations with staff and mentors. Most participants preferred faceto-face interactions when possible. Regular communication with encouragement, constructive, open and respectful tones was found to be critical to foster successful mentorships. EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM Scott-Herring, M., & Singh, S. (2017). Development, Implementation, and Evaluation of a Certified Registered Nurse Anesthetist PreceptorshipMentorship Program. Quality Improvem ent project Level 6 Spiva et al., 2017. Quasiexperimen tal Effectiveness of an Evidence-Based Practice Nurse Mentor Training Program. Level 3 56 Preceptors (n=12) 3-education sessions CRNA orientees (n=3-5) Satisfaction and comfort in preceptor experience Con N= 66 mentors, 367 RNs Training provided to all didactic instruction, resources, Anonymous paper Pre and Follow-Up Preceptor Education Surveys, New Hire CRNA Survey The mean scores improved from pre-test (23.08) to posttest (26.5) in confidence on preceptor ability however it was not statistically significant. Flyers were distributed at five hospitals with link to internet survey Utilizes a Pre & Post-test on training EBP mentors provided with education on; didactic instruction, resource locations, and EBP culture. Showed online training module and nurse mentor improved results perception of knowledge of mentees t = 5.65, p < .001, clinical skills, t = 6.73, p < .001. and research utilization t = 8.25, p < .001 (Spiva et al., 2017). There was a statistically significant improvement in mentoring (Pre education: M=2.9-3.8 Post Education: M= 3.2=3.8, p=<.05). Knowledge Clinical skills and research utilization evaluated Tuomikoski, et al., 2020. How mentoring education affects nurse mentors' competence in mentoring students during clinical practice - QuasiExp erimental Level 3 Nurses (n=120) Education 2 MCI: Mentor a year for Competency three months; Instrument Knowledge of mentoring, The two CRNAs filled out the New Hire CRNA survey both stated either mostly or very much satisfied with their orientation. EVALUATING MARIANS STUDENT MENTORSHIP PROGRAM van Dongen, et al., 2021 Developing leadership in postdoctoral nurses: A longitudinal mixed-methods study. Mixed Method Study Level 4 Nurse (n=12) 57 evaluation of students, identifying student needs, constructive feedback, goal orientation and supporting the student learning process 2 year programme with semistructured interviews and education Leadership and professional development improvement and research productivity Competence in supporting students learning process, constructive feedback and goal orientation had a statistically significant increase (p<.05). Competence in reflection and mentor motivation did not see a statistically significant increase. Semistructured interviews and Online surveys Participants found successful transfer of new knowledge of leadership skills were successfully integrated into their regular daily practice resulting in good career choices and implementation of their own research.  ...

... PrEP Provision and Persistence among Primary Care Providers Chauna Holder, MSN, BSN, BA, CPH, RN Leighton School of Nursing, Marian University NURS 708: DNP Project Cathryn Baack, PhD, APRN, FNP-BC December 2, 2021 PREP 2 Abstract Background and Review of Literature: This study examined individual opinions from healthcare providers in Indiana about their willingness to prescribe Pre-Exposure Prophylaxis (PrEP) for Human Immunodeficiency Virus (HIV). Purpose: Describe facilitators and barriers to providers willingness to prescribe PrEP in order to inform policies and procedures to improve PrEP use as a prevention tool amongst targeted populations. Methods: Healthcare providers were administered a pre-test assessment to assess current knowledge about PrEP. A brief educational intervention was shared, and post-test administered to evaluate any change in knowledge and attitudes towards PrEP provision. Procedures: Electronic mail, online survey tools and personal interviews were used to obtain information about the willingness to prescribe PrEP to patients and responses were deidentified for confidentiality and anonymity prior to analysis and distribution of results. Pre- and post-test assessments were derived from published tools (used with permission) to assess PrEP attitudes, knowledge, and skills. The survey captured information about healthcare provider demographics, education, and opinions, in addition to knowledge and attitudes about PrEP, including initiation of treatment, prescribing, maintenance and discontinuation of services. Implications/Conclusion: Responses obtained overwhelmingly supported provider education about PrEP, standardized protocols, and policies about PrEP provision at the practice and institution levels and supported expert practitioners on hand within the practice to use as real-time resources when questions arise, consistent with earlier published studies. Keywords: PrEP, HIV, PEP, protocols, policies PREP 3 PREP 4 Introduction HIV (human immunodeficiency virus) is a scourge that has been plaguing the world for more than 40 years. Although treatment and long-term survival after infection have dramatically increased, new cases of HIV continue affecting some populations more than others, namely women, youth, and racial, ethnic and gender minorities, and those who suffer with substance use or work in the commercial sex trades. Pre-exposure prophylaxis (PrEP) is the use of HIV antiretroviral medications to prevent HIV in the uninfected. PrEP has been available by prescription since 2012, and is an effective tool to prevent HIV acquisition, yet is underutilized, especially in those groups that would most benefit. To better recognize the benefits of PrEP, namely prevention of incident HIV cases, healthcare providers who are outside the realm of infectious disease must be familiar with PrEP and recommend appropriate use for those who will most benefit. For more people to have access to PrEP, providers must be made aware of the existence of PrEP, the recommended patient audience and appropriate monitoring. The very paradox that exists with PrEP is that those who are most likely to benefit are the least likely to be aware of its availability. Background In 2018, the most recent year for which there is data, there were 37,832 new cases of HIV diagnosed in the United States. Of those cases, 42% were among African Americans, 19% among women and 21% among youth aged 13-24 years (Centers for Disease Control and Prevention [CDC], 2020). In Indiana, for the same year, there were 522 new diagnoses of HIV/AIDS (acquired immunodeficiency syndrome). In Indiana, many cases occurred in the 2039 years and 40- 50+ years groups, with the next affected group being those aged 13-19 years, respectively (Indiana Department of Health, 2020). In Indiana, African Americans comprise nearly 50% of new cases of HIV/AIDS. Risk factors most represented in Indiana include men PREP 5 who have sex with men (MSM), heterosexuals, and those with no identified risk, respectively. In the United States, HIV prevalence rates in urban poverty areas were inversely related to annual household income-the lower the income, the greater the HIV prevalence rate (Denning & Dinenno, 2010, Results section, HIV Prevalence rate by income). All these data indicate that HIV continues to be a burden, particularly to women, people of color and lower income Commented [CB1]: When you use a direct quote, you must include the page number the quote came from in the citation. individuals. PrEP is used by people without HIV who are at risk of being exposed to HIV through sexual contact or injection drug use. Two medications have been approved for use as PrEP by the FDA (United States Food and Drug Administration). Each consists of two drugs combined in a Commented [CB2]: single oral tablet taken daily (CDC, 2020, para. 2). Although infectious disease providers have Commented [CB3]: This is missing on your reference list. Or is FDS supposed to be FDA? traditionally been responsible for diagnosing and treating those affected by HIV/AIDS, the wide Commented [CB4]: If the direct quote is from a website, you give the paragraph number it came from availability of antiretroviral drugs has dramatically changed the pool of providers who can provide care for those infected. Further, there are no special requirements for healthcare providers to prescribe PrEP. Primary care providers who routinely see people at risk for HIV acquisition should consider offering PrEP to all eligible patients (CDC, 2020, HIV prevention guidelines). Finally, the U. S. Preventive Services Task Force has given PrEP a grade A Commented [CB5]: See above comment recommendation[indicating] that their review found that there is high certainty that the net benefit of this service is substantial (CDC, 2020, Not enough people who could benefit from PrEP receive it). Broad provision of PrEP to those who are at risk for acquiring HIV will be required to increase uptake of PrEP and realize the benefits of prevention efforts. In addition to daily, oral PrEP medication, individuals at risk should still be counseled to reduce behaviors that could lead to HIV infection, including using barrier contraceptives and not sharing equipment used to Commented [CB6]: I dont think you need to quote so much here. Put this in your own words and just cite it. PREP 6 prepare or inject drugs. In addition, PrEP requires high adherence, meaning that it is most effective when taken regularly. Barriers to PrEP provision and persistence, as documented in the literature, include a lack of provider awareness, systemic barriers in the healthcare system (insurance approval, cost of medication, delays in provision, testing delays), and stigma, amongst other issues (Holder, 2020). To overcome these barriers, a coordinated and systematic approach to address pertinent individual issues should be employed for vulnerable populations. Increasing provider awareness of PrEP and addressing concerns about its provision to at-risk clients will result in broader availability of PrEP, increasing the defenses against HIV acquisition and decreasing community burden of HIV/AIDS. Even though HIV has been a public health problem for more than 40 years, most providers still treat HIV as a specialty disease rather than as a chronic, treatable disease that can be managed by most general practitioners. As Public Health providers have been tasked with Ending the HIV Epidemic (ETE) in the next 10 years, PrEP is an important HIV prevention tool for those at high risk of contracting HIV. Provider education in family practice offices to increase prescribing of PrEP could help to curb additional new cases of HIV. Initially, PrEP was only available to cisgender men, but is now being recommended for both cisgender men and women for prevention of HIV acquisition amongst high-risk individuals, including women of childbearing age. Providers who are unfamiliar with HIV treatment are likely reluctant to offer PREP due to lack of familiarity with its use and may benefit from provider education about appropriate prescribing, monitoring, and discontinuation of PREP. Problem Statement For providers of high-risk HIV negative persons, does a provider education intervention about appropriate prescribing, maintenance, and discontinuation of Pre-Exposure Prophylaxis PREP 7 (PREP) increase willingness to prescribe PrEP (attitude/knowledge) as compared to before the provider education intervention? Gap Analysis The review of literature suggests that among targeted populations, heterosexual Black and Latinx males may be overlooked when attempting to provide PrEP to vulnerable populations. The literature also suggests that a paradox exists with PrEP where those most likely to benefit from PrEP are least likely to be aware of its existence and availability. Varying methods may need to be employed to reach providers of these specific populations in order to increase awareness and uptake of PrEP for HIV prevention. Review of Literature The Marian University Library electronic database system was used to conduct a literature search using the keywords PrEP for HIV and returned 9410 results. The search was then narrowed using full text online, peer reviewed, downloadable article, 2016 through 2020 and English language, which decreased results to 453 items. Articles were selected for consideration based on title and topic, related to the knowledge, awareness, and willingness to prescribe PrEP, down to 46 articles. Of those 46, the articles were grouped manually for relevance to proposed topic, resulting in 30 articles. Of the 30 remaining, 15 were relevant to the intended goal, with 3 articles excluded as editorial, invited article, and one non-research article. The resulting 12 articles were included in the initial review of literature. Healthcare Provider Pre-exposure Prophylaxis (PrEP) Prescribing Several factors contribute to a healthcare providers willingness to prescribe pre-exposure prophylaxis (PrEP) for the prevention of Human Immunodeficiency Virus (HIV), the overarching barrier being lack of knowledge about the specifics of PrEP. A review of 12 articles PREP 8 in the current literature about provider and patient barriers and facilitators to uptake of PrEP in HIV negative persons elicited several themes, briefly outlined herein. Overall, a lack of provider education about PrEP was noted to be a significant barrier to prescribing. Bunting, Garber, Goldstein, Ritchie, Batteson & Keyes (2020) found that 83.4% of students in several medical disciplines reported being aware of the existence of PrEP, but 62.2% of those were self-taught, meaning PrEP was not included in their formal education (Calabrese, Magnus, Mayer, et.al, 2016; Koechlin, Fonner, Dalglish, et.al, 2017; Zhang, Mitchell, Xue, et.al, 2020). Over a oneyear period, the willingness to prescribe PrEP increased from 51.8% to 65.7% of participants who received training about PrEP (Pinto, Kay, Wall & Choi, 2019) and provider willingness to prescribe PrEP ranged from 9-19% (Koechlin, Fonner, Dalglish, et.al, 2017). There appeared to be an inverse relationship between provider age and willingness to prescribe PrEP; as provider age increased in nurse practitioners (NPs), there was decreased awareness of PrEP, yet NPs were more likely than medical doctors (MDs) to prescribe (Leech, Christiansen, Linas, et.al, 2020). Once PrEP training was completed, providers suggested to include and emphasize education on sexual history taking and sexual minority competence, particularly (Calabrese, Magnus, Mayer, et.al, 2016). Barriers and Facilitators of PrEP Varied and numerous are the barriers to maximum PrEP prescription to targeted populations. Although adherence to regimen, risk compensation (Calabrese, Magnus, Mayer, et.al, 2016), safety, and effectiveness of the treatment (Koechlin, Fonner, Dalglish, et.al, 2017) were listed, the emphasis was decidedly on broader concerns of financial coverage (Calabrese, Magnus, Mayer, et.al, 2016; Chan, Chappel, Joynt Maddox, et.al, 2020; Koechlin, Fonner, Dalglish, et.al, 2017;Mayer, Agwu & Malebranche, 2020; Pinto, Berringer, Melendez & Mmeje, 2018), eligibility determination (Calabrese, Magnus, Mayer, et.al, 2016; Chan, Chappel, PREP 9 Maddox, et.al, 2020; Kundu, Martinez-Donate, Karkada, et.al, 2019) implementation logistics (Calabrese, Magnus, Mayer, et.al, 2016; Chan, Chappel, Maddox, et.al, 2020; Skolnik, Bokhour, Gifford, et.al, 2019), side effects (Calabrese, Magnus, Mayer, et.al, 2016; Koechlin, Fonner, Dalglish, et.al, 2017; Mayer, Agwu & Malebranche, 2020) and accessing the primary populations intended to benefit from PrEP (Calabrese, Magnus, Mayer, et.al, 2016; Mayer, Agwu & Malebranche, 2020; Pinto, Berringer, Melendez & Mmeje, 2018; Skolnik, Bokhour, Gifford, et.al, 2019; Vanhamel, Rotsaert, Reyniers, et.al, 2020). In the article by Chan, Chappel, Joynt Maddox, et.al, 2020, those patients receiving PrEP were likely to vary widely from the intended population (i.e. well-resourced, insured, educated persons). Of the 35% of patients who experienced delays in receiving PrEP once prescribed, delays were noted between six weeks and six months (Skolnik, Bokhour, Gifford, et. al, 2019). Other barriers included stigma (either on the part of the provider or the patient) (Koechlin, Fonner, Dalglish, et. al, 2017; Mayer, Agwu & Malebranche, 2020; Pinto, Berringer, Melendez & Mmeje, 2018; Skolnik, Bokhour, Gifford, et.al, 2019), decreased risk perception (Koechlin, Fonner, Dalglish, et. al, 2017; Mayer, Agwu & Malebranche, 2020), the idea that medications are only for sick people (Koechlin, Fonner, Dalglish, et. al, 2017), lack of educational attainment, fear of provider bias and distrust of the healthcare system (Mayer, Agwu & Malebranche, 2020). Koechlin, Fonner, Dalglish, et.al, (2017) found that social support, especially of sexual partners, ability to control the method and a simplified, one-pill per day regimen were facilitators of PrEP uptake and persistence among the literature reviewed. Opportunities Although eligible by PrEP guidelines, heterosexual men, especially Black and Latinx men, were all but absent from the literature, indicating a population that could benefit from PrEP PREP 10 if barriers to patient access are overcome (Koechlin, Fonner, Dalglish, et.al, 2017). The approach to increasing provider and patient uptake of PrEP to prevent HIV acquisition must be multifaceted in order to attempt to address the many barriers already identified in the literature. Theoretical Framework The Socio-Ecological Model (SEM) is an adaptation of Bronfenbrenners ecological model of human development, created by Urie Bronfenbrenner in 1977 to help explain the many forces that interact to shape a childs development (Bronfenbrenner, 1977). Bronfenbrenner depicted the model as five concentric circles, each circle representing the level of systematic influence on the childs development. At the center is the child/individual/microsystem. The next surrounding circle contains the mesosystem of localities, communities, and schools. The third circle is comprised of the exosystem and contains mass media, policies, and government institutions. The fourth circle is the macrosystem, containing the ideologies of the culture. The fifth circle, the chronosystem, is comprised of both internal and external elements of time and historical content (Appendix A). The microsystem exerts the most influence on the individuals development, focusing on relationships and interactions at the personal level. With each successive level, there are influences that help to shape development, yet they are further and further removed from the individuals personal experiences and can be both positive and negative forces. The SEM adapted Bronfenbrenners concept to include health and the major contributors that may influence individual health (Appendix B). The SEM states that health is affected by the interaction between the characteristics of the individual, the community, and the environment that includes the physical, social, and political components (Kilanowski, 2017, p. 1). The SEM is also represented as a series of concentric circles with levels increasing from individual to interpersonal, institutions and organizations, community, structures, and systems, Commented [CB7]: Need page number PREP 11 and has been widely adapted by the Centers for Disease Control and Prevention for application to several public health issues (Kilanowski, 2017), sometimes represented with four levels, but not more than five. The model attempts to account for the many levels of influence that shape an individuals health and health choices, recognizing the interaction between levels to shape individual choice. The SEM framework has been chosen for this project to attempt to characterize and address the many levels of influence that interact with an individual healthcare providers choice to prescribe pre-exposure prophylaxis (PrEP) and those barriers that the individual who may benefit from PrEP is likely to encounter. When seeking healthcare, often the individual expresses a desire to improve an aspect of their personal health, but various barriers must be overcome in order to achieve that goal. Barriers often include personal knowledge of risks and benefits of continued behavior, time constraints, material resources, access, and stigma, amongst others, and will vary from person to person. In attempting to diversify the patient population prescribed PrEP, the SEM framework will assist in identifying concepts and that interact to shape the choice of the provider to prescribe PrEP and how to overcome barriers to prescription to increase appropriate provision to those most likely to benefit from HIV (human immunodeficiency virus) acquisition. Goals, Objectives, and Expected Outcomes The goal of this project is to increase healthcare provider awareness of appropriate prescribing, maintenance, and discontinuation of pre-exposure prophylaxis for the prevention of human immunodeficiency virus acquisition (PrEP for HIV). Student investigator shall complete a pre- and post-test assessment, providing an educational intervention about PrEP according to current clinical practice guidelines, over the DNP II and DNP III courses. PREP 12 Project Design Primary care providers and other healthcare providers outside the practice of infectious diseases shall be administered a pre-test assessment to ascertain current knowledge about PrEP. A brief educational intervention will be shared, and post-test administered to evaluate any change in knowledge and attitudes towards PrEP provision. Data will be analyzed for themes and suggestions provided, with results disseminated appropriately. Project Site The anticipated location of the project will be individual and group provider practices treating the target populations within Central Indiana and may extend to rural providers who may benefit from the educational intervention. Methods Pre- and post-test assessments will be derived from published tools used to assess PrEP attitudes, knowledge, and skills. Paired results will be analyzed for changes in knowledge, skills, attitudes, and willingness to prescribe PrEP. Measurement Instrument(s) A standardized pre- and post-test assessment will be used to assess knowledge before and after the educational intervention. The educational intervention will either be taken directly from the CDC PrEP for providers educational materials or materials from the pharmaceutical suppliers, or a combination of these resources. Data Collection PREP 13 Data will be collected using either 1:1 interviews or emailed assessments and interventions. In light of the ongoing pandemic, alternative electronic methods may need to be developed to facilitate provider participation. Data Analysis Using a pre- post-test analysis, a paired t-test seems appropriate to analyze the data collected. Any suggestions gleaned from personal communication with providers will also be compiled. Timeline The project is anticipated to occur over a period of 4-7 months from institutional review board (IRB approval) to dissemination. Demographic Results The proposed project differed from the actual project significantly due to COVID-19 accommodations and availability of subjects. Upon receiving IRB approval, the student researcher partnered with the Coalition of Advanced Practice Nurses of Indiana (CAPNI) to distribute the survey to its membership database of over 1500 members. Initially proposed as a pre- and post-test assessment with an educational component, the final survey was comprised of 36 questions regarding demographics, knowledge of PrEP, and perceived barriers and facilitators of PrEP prescribing in primary care settings. Survey questions were chosen from two tools used in a similar study by Dr. Dawn Robinson-Meadows (2019). Distribution using the CAPNI email listserv worked to decrease potential exposures to COVID-19 during face-to-face encounters, facilitated access throughout the state of Indiana and facilitated responses that could be completed at the convenience of the respondent. Respondents self-selected to complete the survey, returning 38 responses (2% response rate), 36 of which were complete and included in PREP 14 the analysis. Surveys were collected over a period of 5 weeks, from July 22 to August 25, 2021, using Qualtrics software. Respondents included nurse practitioners who were employed in outpatient settings (89%), provided supervision of trainees (61%), and practiced in the Midwest (95%), comprised of the states of Indiana, Illinois, Iowa, Kansas, Michigan, Minnesota, Missouri, Nebraska, North Dakota, South Dakota, Ohio, Oklahoma, and Wisconsin. Respondents classified themselves as providing patient care 100% of their time compared to research, medical education, administration or other duties. Practices were classified by the respondent as either rural (32%), suburban (27%) or urban (41%). The majority of respondents described their clinical setting as community health center (31%) or clinic at a public hospital (25%) with the remainder spread amongst clinic at an academic medical center(11%), clinic at a VA hospital (2%), inpatient hospital setting (8%), private practice (14%) and other (8%), with the focus of the practice being primary care but no HIV treatment (50%). All respondents were nurse practitioners; 89% of respondents identified as female, 83% heterosexual, 83% White, aged 26-67 years and not of Hispanic/Latino(a) ethnicity. Respondents had been in practice less than 5 years (38%), 5-10 years (32%), 10-15 years (11%), 15-20 years (8%), and greater than 20 years (11%). Descriptive Statistic Results Using Qualtrics online data collection and analysis software, the survey questions were formatted using a standard template and distributed via hyperlink using the CAPNI distribution list. Questions included in the survey were chosen from the work of Blumenthal and colleagues (2015) and Robinson-Meadows (2019) to ascertain familiarity with PrEP, patient requests for PrEP, and real or perceived barriers and facilitators to prescribing PrEP in primary care practice. PREP 15 Questions 3 and 4 regarding existing PrEP knowledge revealed 97% of respondents were familiar with PrEP prior to the survey, with 32% rating their knowledge of PrEP as good, 26% rating their knowledge as very good, and 5% rating their knowledge as excellent; 37% rated their existing knowledge of PrEP as fair or poor. Question 5 asked respondents to rate their knowledge of PrEPs potential side effects with 45% of respondents answering fair or poor, while 55% responded excellent, very good, or good. Question 6 found that 66% of respondents believed PrEP to be effective in preventing HIV when taken as prescribed. Question 7 returned 74% of respondents agreeing that if a patient reported using condoms consistently and correctly that it was very important to still offer PrEP, and no respondents replied that PrEP was not at all important. Considering the side effect profile for PrEP, all respondents rated PrEP as either moderately safe at 60%, or very safe at 40%, with no rating lower than moderately safe. Considering prescribing habits for PrEP, 34% responded they were not at all likely to prescribe PrEP in the next 6 months, while the remaining 66% responded at least somewhat likely. Comfort with prescribing PrEP yielded similar results with 24% responding that they were not comfortable, while 76% responded at least slightly comfortable or better. 58% of respondents had ever been asked about PrEP by a patient, and 58% have initiated a conversation with a patient about PrEP. 55% of respondents had never prescribed PrEP to a patient, and 58% had never referred a patient for PrEP to be provided by another provider or at another location. Questions 12 and 13 sought to correlate sexual risk-taking practices with PrEP use, with 14% of respondents indicating not at all likely to increase risk behavior, while 86% indicated at least somewhat likely to extremely likely to increase risky behavior (e.g. decrease condom use). Conversely, 70% of respondents answered that patients may decrease risk-taking behaviors PREP 16 as a result of using PrEP. When asked about comfort with evaluating PrEP eligibility for clients, respondents reported being most comfortable evaluating heterosexual and homosexual patients compared to those who inject drugs, regardless of sexual preference. Some 8-14% of respondents were consistently reluctant to prescribe PrEP based on risk behavior, while 49-62% were always willing to prescribe. The majority of respondents (50%) reported caring for 1-10 HIV-positive patients in their current practice and reported that of those eligible for routine HIV testing, only 44% report routine testing being offered. Barriers to PrEP prescribing were rated amongst respondents with lack of provider training/education regarding PrEP and lack of clinic guidelines/protocol for prescribing/monitoring PrEP being most often chosen as extremely likely, lack of insurance coverage and out-of-pocket patient costs rated moderately likely, and clinical and lab monitoring requirements and staffing/time constraints rated somewhat likely. Facilitators of PrEP prescribing, in descending order, were rated to be peers who are knowledgeable about or supportive of PrEP provision within the practice, practice or institutional willingness to implement new clinical protocols, access to resources such as PrEP prescription guidelines and protocols, and on-site support. Respondents thought that the most feasible approach to increasing PrEP prescribing in practice would be to have all providers in the practice receive training to provide PrEP and prescribe to eligible persons at 50%, followed closely by one provider as a PrEP specialist in the practice at 31%. Discussion The results of this study support provider education, practice protocol development and policy implementation around PrEP provision in primary care practices. Initially, the goal of this project was to increase healthcare provider awareness of appropriate prescribing, maintenance, PREP 17 and discontinuation of pre-exposure prophylaxis for the prevention of human immunodeficiency virus acquisition (PrEP for HIV) using a pre- and post-test format with an educational intervention. Due to the ongoing COVID-19 pandemic, the project was reimagined as an assessment of provider awareness of PrEP, comfort with prescribing, and perceived barriers and facilitators to PrEP prescribing in primary care practice. Responses obtained overwhelmingly supported provider education about PrEP, standardized protocols, and policies about PrEP provision at the practice and institution levels, and expert practitioners on hand within the practice to use as real-time resources when questions arise. These results were consistent with those reported by Robinson-Meadows (2019) and the literature reviewed as indicated above. As provider education and familiarity with PrEP increases, it follows that PrEP will be made more widely available amongst those clients who could most benefit from its use (Logo, et.al, 2017). Additional opportunities for provider education, in cooperation with good policy, will promote uptake of PrEP to prevent additional HIV cases, working to end the HIV epidemic. Project Barriers and Facilitators The most significant barrier to this project was the low response rate. Of the available more than 1500 nurse practitioners in the CAPNI email listserv, only 38 responses were generated over a 5-week period with one reminder prompt being sent, which generated a final 5 respondents. Beyond the response rate, provider fatigue undoubtedly played a role in providers being willing to respond to any additional tasks asked of them in light of the ongoing demands of the current pandemic. At the time the survey was issued, providers and first-line workers in all fields, had been battling COVID-19 some 16 months without relief. Finally, not all providers in the CAPNI database are actively employed in healthcare and may not specialize in primary care, further reducing the number of targeted respondents available. Additionally, barriers to PrEP PREP 18 may be perceptions about the time investment required to learn how to take a proper sexual history or comprehensive risk inventory. Although respondents for this survey did not indicate staffing or time constraints as high-ranking barriers, additional requirements of providers must be considered when implementing or promoting a new practice protocol, including time, material resources, and educational needs. Facilitators Using an online software program for survey development and coding, coupled with unlimited access facilitated responses from busy providers. Access to a database of specifically trained individuals allowed for rapid deployment and the unique data signature created with each response allowed for remarkable data quality over traditional methods. A relatively short survey, with a total of 36 questions, 16 of which were regarding respondent demographics, leaving 20 to focus on PrEP knowledge, services and attitudes hopefully kept respondents engaged and focused on the task at hand. A personal introduction to the survey from an aspiring nurse practitioner student may also have contributed to respondent willingness to complete the survey. Implications for Practice Nurse practitioners are frequently primary care providers who are charged with holistic care of the individual. Doctor of Nursing Practice Essentials enumerate the use of research in practice, innovation, and quality improvement in disease prevention and health promotion (American Association of Colleges of Nursing, 2006). To that end, screening for preventable conditions is a priority for all patients, including behaviors associated with injection drug use and sexually transmitted diseases. Routine screening for HIV is recommended by the United States Preventive Services Task Force (USPSTF), including offering PrEP to individuals at risk for PREP 19 acquiring HIV (USPSTF, 2019). The gap between provider education and practice implementation must be closed in order to realize the benefits of PrEP in reducing the overall burden of incident cases of HIV amongst individuals at risk. Recommendations and Conclusions Consistent with previous studies, this study determined that nurse practitioners are familiar with the concept of PrEP for HIV prevention, providers more education about appropriate screening and referral for PrEP initiation and maintenance and believe that PrEP is an effective tool to prevent new HIV infections. As stated, the gap between knowledge and action must be closed to increase uptake and provision of PrEP to appropriate patients. Nurse practitioners are poised to close the gap and improve the outlook of patients at risk for HIV acquisition with the support of appropriate policy and practice protocols. Future research may focus on successful implementation of rapid PrEP assessment and access, cost containment measures associated with PrEP initiation and maintenance, and comprehensive sexual history and health inventory as part of routine primary care. Dissemination of successful PrEP implementation models in primary care settings may further facilitate uptake and innovation in service delivery. Additional research is warranted in order to maximize the benefits of widespread PrEP availability and appropriate use to prevent new HIV infections. PREP 20 References Blumenthal, J., Jain, S., Krakower, D., Sun, X., Young, J., Mayer, K., & Haubrich, R. (2015). Knowledge is power! Increased provider knowledge scores regarding pre-exposure prophylaxis (PrEP) are associated with higher rates of PrEP Prescription and Future Intent to Prescribe PrEP. AIDS Behavior, 19(5), 802-810. http://dx.doi.org/10.1007/s10461-015-0996-z Bunting, S. R., Garber, S. S., Goldstein, R. H., Ritchie, T. D., Batteson, T. J., & Keyes, T. J. (2020). Student education about pre-exposure prophylaxis (PrEP) varies between regions of the United States. Journal of General Internal Medicine, 35(10), 28732881. https://doi.org/10.1007/s11606-020-05736-y Calabrese, S. K., Magnus, M., Mayer, K. H., Krakower, D. S., Eldahan, A. I., Gaston Hawkins, L. A., Hansen, N. B., Kershaw, T. S., Underhill, K., Betancourt, J. R., & Dovidio, J. F. (2016). Putting PrEP into practice: lessons learned from early-adopting U. S. providers' firsthand experiences providing HIV pre-exposure prophylaxis and associated care. PLoS One, 11(6). https://doi.org/10.1371/journal.pone.0157324 Centers for Disease Control and Prevention. (2020). HIV and African Americans. Retrieved December 10, 2020, from https://www.cdc.gov/hiv/group/racialethnic/africanamericans/ Centers for Disease Control and Prevention. (2020). HIV and women. Retrieved December 10, 2020 from https://www.cdc.gov/hiv/group/gender/women/index.html Centers for Disease Control and Prevention. (2020). HIV and youth. Retrieved December 10, PREP 21 2020 from https://www.cdc.gov/hiv/group/age/youth/index.html Centers for Disease Control and Prevention. (2020). Pre-exposure prophylaxis (PrEP). Retrieved December 10, 2020, from https://www.cdc.gov/hiv/clinicians/prevention/prep.html Chan, S. S., Chappel, A. R., Joynt Maddox, K. E., Hoover, K. W., Huang, Y.-L. A., Zhu, W., Cohen, S. M., Klein, P. W., & DeLew, N. (2020). Pre-exposure prophylaxis for preventing acquisition of HIV: A cross-sectional study of patients, prescribers, uptake, and spending in the United States, 2015-2016. PLoS Medicine, 17(4): e1003072. https://doi.org/10.1371/journal.pmed.1003072 Denning, P. & Dinenno, E. (2010). Communities in crisis: Is there a generalized HIV epidemic in impoverished urban areas of the United States. https://www.researchgate.net/publication/317358394_Communities_in_Crisis_Is_There_ a_Generalized_HIV_Epidemic_in_Impoverished_Urban_Areas_of_the_United_States Indiana Department of Health. (2020). At a glance: Semi-annual HIV/AIDS, STD, and Hepatitis B & C data. https://www.in.gov/isdh/files/At%20A%20Glance2019.pdf Kilanowski, Jill. (2017) Breadth of the Socio-Ecological Model. Journal of Agromedicine, 22(4), 295-297. DOI: 10.1080/1059924X.2017.1358971 Koechlin, F.., Fonner, V. A., Dalglish, S. L., O'Reilly, K. R., Baggaley, R., Grant, R. M., Rodolph, M., Hodges-Mameletzis, I., & Kennedy, C. (2017). Values and preferences on the use of oral pre-exposure prophylaxis (PrEP) for HIV prevention among multiple PREP 22 populations: a systematic review of the literature. AIDS and Behavior, 21(5), 13251335. https://doi.org/10.1007/s10461-016-1627-z Kundu, I., Martinez-Donate, A., Karkada, N., Roth, A., Felsher, M., Sandling, M., & Szep, Z. (2019). Attitudes and referral practices for pre-exposure prophylaxis (PrEP) among HIV rapid testers and case managers in Philadelphia: A mixed methods study. PLoS One, 14(10): e0223486. https://doi.org/10.1371/journal.pone.0223486 Leech, A. A., Christiansen, C. L., Linas, B. P., Jacobsen, D. M., Morin, I., & Drainoni, M.-L. (2020). Healthcare practitioner experiences and willingness to prescribe pre-exposure prophylaxis in the US. PLoS ONE, 15(9): e0238375. https://doi.org/10.1371/journal.pone.0238375 Logo, M. K., Danawi, H., & Ferraro, A. (2017). Prescribing HIV PrEP and education needs among care providers. Journal of Social, Behavioral, and Health Sciences, 11(1), 202214. http://dx.doi.org/10.5590/JSBHS.2017.11.1.14 Mayer, K. H., Agwu, A., & Malebranche, D. (2020). Barriers to the wider use of pre-exposure prophylaxis in the United States: A narrative review. Advances in Therapy, 37(5), 1778 1811. https://doi.org/10.1007/s12325-020-01295-0 Pinto, R. M., Berringer, K. R., Melendez, R., & Mmeje, O. (2018). Improving PrEP implementation through multilevel interventions: A synthesis of the literature. AIDS and Behavior, 22, 3681-3691. https://doi.org/10.1007/s10461-018-2184-4 Pinto, R. M., Kay, E. S., Wall, M. M., & Choi, C. J. (2020). Interprofessional collaboration PREP 23 improves the odds of educating patients about PrEP over time. Journal of General Internal Medicine, 35(5), 14441451. https://doi.org/10.1007/s11606-019-05616-0 Robinson-Meadows, D. (2019). Expanding PrEP into the Primary Care World: Increasing provider knowledge of PrEP to improve HIV prevention services. Indiana State University Department of Advanced Practice Nursing. Unpublished manuscript used with permission. Skolnik, A. A., Bokhour, B. G., Gifford, A. L., Wilson, B. M., & Van Epps, P. (2019). Roadblocks to PrEP: What medical records reveal about access to HIV pre-exposure prophylaxis. Journal of General Internal Medicine, 35(3), 832838. https://doi.org/10.1007/s11606-019-05475-9 United States Preventive Services Task Force. (2017). Prevention of human immunodeficiency virus (HIV) infection: Pre-exposure prophylaxis. Retrieved November 23, 2021 from https://www.uspreventiveservicestaskforce.org/uspstf/recommendation/prevention-ofhuman-immunodeficiency-virus-hiv-infection-pre-exposure-prophylaxis Vanhamel, J., Rotsaert, A., Reyniers, T., Nostlinger, C., Laga, M., Van Landeghem, E., & Vuylsteke, B. (2020). The current landscape of pre-exposure prophylaxis service delivery models for HIV prevention: A scoping review. BMC Health Services Research, 20, 704721. https://doi.org/10.1186/s12913-020-05568-w Zhang, C., Mitchell, W., Xue, Y., LeBlanc, N., & Liu, Y. (2020). Understanding the role of PREP 24 nurse practitioners, physician assistants and other nursing staff in HIV pre-exposure prophylaxis care in the United States: A systematic review and meta-analysis. BMC Nursing, 19(1), 117-125. https://doi.org/10.1186/s12912-020-00503-0 PREP 25 Appendices Appendix A: Ecological Model of Human Development, Bronfenbrenner, U. (1994) Socio- ecological model adopted from Bronfenbrenners ecological model of human development. Source: Ecological Models of Human Development, by U. Bronfenbrenner, 1994, in International Encyclopedia of Education (pp. 37-42), Oxford, UK: Elsevier. PREP Appendix B: Socio-ecological model of barriers to PrEP implementation Pinto, R. M., Berringer, K. R., Melendez, R., & Mmeje, O. (2018). Improving PrEP implementation through multilevel interventions: A synthesis of the literature. AIDS and Behavior, 22, 3681-3691. https://doi.org/10.1007/s10461-018-2184-4 26 PREP 27 Appendix C: PrEP Provision Among Primary Care Providers PrEP Provision Among Primary Care Providers Q1. Do you currently provide direct clinical care in an outpatient setting? Yes No Q2. Do you currently supervise trainees in an outpatient setting? Yes No Q3. Before today, had you heard of PrEP? Yes No Q4. Before today, how would you rate your knowledge of PrEP? Excellent Very Good Good Fair Poor Q5. Before today, how would you rate your knowledge of PrEPs potential side effects (e.g., renal dysfunction)? Excellent Very Good Good Fair Poor PREP 28 Q6. How effective do you think PrEP is in preventing acquisition of HIV among people who take it every day as prescribed? Not effective at all Slightly effective Moderately effective Very effective Q7. If a patient says he/she is using condoms consistently and correctly, how important is it to offer PrEP in addition to condoms? Not at all important Slightly important Moderately important Very important Q8. Based on your understanding of PrEP side effects, how safe is PrEP? Not at all safe Slightly safe Moderately safe Very safe Q9. How likely are you to prescribe PrEP in the next 6 months? Not at all likely Somewhat likely Moderately likely Very likely Q10. If you identified a patient at high risk for HIV acquisition, what is your level of comfort with prescribing PrEP? Not comfortable Slightly comfortable Moderately comfortable PREP 29 Very comfortable Q12. How likely do you think the patient would be to increase his/her sexual risk-taking practices (e.g., decrease condom use) as a result of being on PrEP? Not at all likely Slightly likely Moderately likely Extremely likely Q13. How likely do you think the patient would be to decrease his/her sexual risk-taking practices (e.g., increase condom use) as a result of being on PrEP? Not at all likely Slightly likely Moderately likely Extremely likely Q14. Have you ever been asked about PrEP by a patient? Yes No Q15. Have you ever initiated a conversation about PrEP with a patient? Yes No Q16. Have you ever prescribed PrEP to a patient? Yes No Q17. Have you ever referred a patient for PrEP (e.g., to a PrEP provider or HIV clinic)? Yes No PREP 30 Q18. Rate the degree to which each of the following is a potential barrier to prescribing PrEP at your primary clinic Not likely Somewhat Likely Moderately likely Extremely likely Lack of provider training/education regarding PrEP Lack of clinic guidelines/protocol for prescribing/monitoring PrEP Clinical and lab monitoring requirements (e.g., seeing patient and obtaining HIV tests and STI screening every 3 months; checking renal function every 6 months) Staffing/time constraints related to risk reduction and PrEP adherence counseling (also medication knowledge/counseling re: Truvada, adverse effects, etc.) Lack of insurance coverage and out-of-pocket patient costs for PrEP and related care (e.g., lab work) Q19. Rate the degree to which each of the following would facilitate your prescribing PrEP at your primary clinic PREP 31 Not at all likely Somewhat likely Moderately likely Extremely likely Access to resources such as PrEP prescription guidelines and protocols On-site support (i.e., risk reduction or adherence counselors, social workers) Practice or institutional willingness to implement new clinical protocols Peers who are knowledgeable about or supportive of PrEP provision within your practice Q20. In your opinion, which approach do you think would be most feasible to implement PrEP in your clinical practice setting? All providers in the practice receive training to provide PrEP and prescribe to eligible patients One provider in the practice is appointed as a PrEP specialist (i.e., a provider who receives specific training on PrEP and to whom all eligible patients in the practice are referred) No providers in the practice receive training or provide PrEP; rather, patients are referred outside the practice (e.g., to an Infectious Disease Clinic or STD clinic) Other (please specify) Q21. For each of the following risk behavior categories, how comfortable are you evaluating eligibility for PrEP? Not at all uncomfortable Women who have sex with men Somewhat uncomfortable Moderately comfortable Extremely comfortable PREP 32 Not at all uncomfortable Somewhat uncomfortable Moderately comfortable Extremely comfortable Men who have sex with women Men who have sex with men People who inject drugs Q22. For each of the following risk behavior categories, how willing are you to prescribe PrEP to an eligible individual, assuming a recent negative HIV test and equal access to medication? Not at all willing A female with a current male partner known to be HIV-positive A female who has unprotected sex with male partners with unknown HIV status who are at high risk of HIV infection (e.g., partner(s) who has sex with other males or uses injection drugs) A male with a current female partner known to be HIV-positive A male who has unprotected sex with male partners with unknown HIV status who are at high risk of HIV infection (e.g., partner(s) who has sex with other males or uses injection drugs) Somewhat willing Moderately willing Extremely willing PREP 33 Not at all willing Somewhat willing Moderately willing Extremely willing A male with a current male partner known to be HIVpositive A male who has sex with multiple male partners and has had unprotected anal sex A person who has injected drugs in the past 6 months and shared injection equipment A person who has been on methadone maintenance for the past 6 months but has continued injection drug use Q23. In what region of the country do you practice? (Choose only one) Mountain West (AZ, CO, NV, NM, UT, AND WY) Midwest (IL, IN, IA, KS, MI, MN, MO, NE, ND, OH, OK, SD, WI) California-Hawaii Northwest (AK, ID, MT, OR, WA) Southern (AL, AK, FL, GA, KY, LA, MS, NC, SC, TN, TX, VA, and WV) Mid-Atlantic (DE, Washington, DC, MD, NJ, NY, PA, Puerto Rico) New England (CT, ME, MA, NH, RI, VT ) Q24. How would you classify the area or region where you practice? (Choose only one) Urban Suburban Rural Q25. What percent of your time do you spend doing each of the following (should total 100%)? PREP 34 Direct clinical care Research Medical education (i.e., teaching or supervising medical trainees) Administration Other (please specify) Q26. What is the single best setting that describes where you care for patients? (Choose only one) Clinic at an academic medical center Clinic at a public hospital Clinic at a VA hospital Clinic at substance abuse treatment center in the community Community health center Inpatient/hospital setting Private practice (unaffiliated with an academic medical center and in the community) Other (please specify) Q27. What is the main focus of the clinic/office where you care for patients? (Choose only one) General medical care/Primary Care (but NO HIV care/treatment) General medical care/Primary Care (WITH HIV care on-site) Infectious diseases (including HIV care) Substance abuse treatment LGBT-focused primary care clinic Other (please specify) Q28. Of the patients you currently provide care for at your clinic/office, approximately how many patients are HIV-positive? 0 PREP 35 1-10 11-20 21-50 51-100 101-200 >200 Q29. Of the patients you currently provide care for at your office, what percent of those who are eligible for routine HIV testing have been offered testing? 0% 1-25% 26-50% 51-75% 76-100% Not applicable (i.e., all of my patients are HIV+) Q30. With respect to gender, how do you self-identify? Female Male Transgender Gender non-conforming Choose not to answer Q31. With respect to sexual orientation, how do you self-identify? Heterosexual Gay Lesbian Bisexual Other (please specify) PREP 36 Q32. What is your current role? MD DO NP PA Q33. I have been in practice _________ years. Less than 5 5-10 >10-15 >15-20 >20 Q34. Please enter the year in which you were born. Birth year (please specify) Q35. With respect to race, how do you self-identify? (Check all that apply) White Black or African American American Indian or Alaska Native Asian or Asian American Native Hawaiian or Pacific Islander Other (please specify) Q36. Do you self-identify as being Hispanic/Latino(a)? Yes No  ...